Incidental Mutation 'R4038:Hspa2'
ID313804
Institutional Source Beutler Lab
Gene Symbol Hspa2
Ensembl Gene ENSMUSG00000059970
Gene Nameheat shock protein 2
Synonyms70kDa, Hsp70-2
MMRRC Submission 040965-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4038 (G1)
Quality Score225
Status Validated
Chromosome12
Chromosomal Location76404176-76406938 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 76405768 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 412 (V412A)
Ref Sequence ENSEMBL: ENSMUSP00000151408 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000080449] [ENSMUST00000219555]
Predicted Effect probably damaging
Transcript: ENSMUST00000080449
AA Change: V412A

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000079306
Gene: ENSMUSG00000059970
AA Change: V412A

DomainStartEndE-ValueType
Pfam:HSP70 7 615 5.8e-269 PFAM
Pfam:MreB_Mbl 117 383 8.5e-18 PFAM
low complexity region 616 627 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000180709
Predicted Effect noncoding transcript
Transcript: ENSMUST00000217797
Predicted Effect probably damaging
Transcript: ENSMUST00000219555
AA Change: V412A

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
Meta Mutation Damage Score 0.5061 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 93.1%
Validation Efficiency 93% (39/42)
MGI Phenotype PHENOTYPE: Homozygotes for a targeted null mutation exhibit male sterility associated with lack of postmeiotic germ cells and markedly increased frequency of spermatocyte apoptosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ate1 A G 7: 130,504,765 S282P probably damaging Het
Cacna1d T A 14: 30,066,083 Q1610L probably damaging Het
Carmil2 C A 8: 105,695,407 R1103S probably damaging Het
Clca3a1 T A 3: 144,755,233 Y219F probably benign Het
Creb3l3 A G 10: 81,089,338 V224A probably benign Het
Crnkl1 T A 2: 145,932,327 D72V possibly damaging Het
Dhcr24 T C 4: 106,573,878 F255L probably benign Het
Eef2kmt A T 16: 5,245,271 V335D probably damaging Het
Elp2 T A 18: 24,634,348 W696R probably damaging Het
Glb1l3 A C 9: 26,829,047 M329R probably damaging Het
Gm4787 A T 12: 81,378,358 F342Y probably damaging Het
Gpr137c C A 14: 45,220,230 L80I probably damaging Het
Gpr83 A G 9: 14,860,777 I82V possibly damaging Het
Greb1l C T 18: 10,515,209 T558I possibly damaging Het
Hnrnpul2 T A 19: 8,823,227 probably benign Het
Iqcd T C 5: 120,602,522 V306A probably damaging Het
Lmod3 T C 6: 97,248,314 N182S probably benign Het
Metrn T C 17: 25,795,010 T281A probably benign Het
Mid1-ps1 G A Y: 90,762,294 noncoding transcript Het
Mmachc T A 4: 116,706,018 T47S probably damaging Het
Nfia C A 4: 98,020,837 R277S probably damaging Het
Olfr1158 T A 2: 87,990,918 I269N possibly damaging Het
Pcdha8 T C 18: 36,992,861 M132T probably benign Het
Prkaa2 T C 4: 105,051,247 N144D probably damaging Het
Ptprf C T 4: 118,257,608 R150H probably damaging Het
Sfmbt1 T G 14: 30,787,492 D309E probably damaging Het
Skint5 G T 4: 113,885,814 T352K unknown Het
Slc16a10 G C 10: 40,056,624 H314D possibly damaging Het
Slc28a2 C A 2: 122,454,515 A328E probably benign Het
Ssc4d C A 5: 135,970,316 W11L possibly damaging Het
Sycp2 C A 2: 178,380,927 M470I possibly damaging Het
Tfap2c A T 2: 172,556,190 S413C probably damaging Het
Unc13c A G 9: 73,533,906 probably null Het
Vmn1r218 T C 13: 23,136,801 V26A possibly damaging Het
Wipf3 G A 6: 54,481,828 G56D probably damaging Het
Wiz T C 17: 32,359,224 E429G probably damaging Het
Zer1 T C 2: 30,107,523 N457S probably damaging Het
Zfp931 T A 2: 178,067,984 Q203L possibly damaging Het
Other mutations in Hspa2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00433:Hspa2 APN 12 76406349 missense possibly damaging 0.94
IGL02946:Hspa2 APN 12 76405173 missense probably damaging 0.99
R0504:Hspa2 UTSW 12 76405216 missense probably damaging 1.00
R1191:Hspa2 UTSW 12 76405881 missense probably damaging 1.00
R1204:Hspa2 UTSW 12 76404867 missense probably benign
R1880:Hspa2 UTSW 12 76405920 missense possibly damaging 0.72
R2234:Hspa2 UTSW 12 76404645 missense possibly damaging 0.56
R2265:Hspa2 UTSW 12 76406188 missense probably benign 0.05
R4036:Hspa2 UTSW 12 76405768 missense probably damaging 1.00
R4037:Hspa2 UTSW 12 76405768 missense probably damaging 1.00
R4039:Hspa2 UTSW 12 76405768 missense probably damaging 1.00
R4120:Hspa2 UTSW 12 76405234 missense probably damaging 1.00
R4673:Hspa2 UTSW 12 76405740 missense possibly damaging 0.89
R4720:Hspa2 UTSW 12 76404865 missense possibly damaging 0.77
R4948:Hspa2 UTSW 12 76405987 missense probably damaging 1.00
R5492:Hspa2 UTSW 12 76404534 start codon destroyed probably null 0.00
R6043:Hspa2 UTSW 12 76406322 missense probably damaging 1.00
R7422:Hspa2 UTSW 12 76406110 missense probably damaging 0.98
R7698:Hspa2 UTSW 12 76405309 missense possibly damaging 0.90
Predicted Primers PCR Primer
(F):5'- ATCCAGAAGCTCCTGCAAG -3'
(R):5'- TCAAAGGTGACCTCGATCTGG -3'

Sequencing Primer
(F):5'- CTGCAAGATTTCTTCAACGGCAAG -3'
(R):5'- TGACCTCGATCTGGGGGAC -3'
Posted On2015-04-30