Mutagenetix > Incidental Mutation

Incidental Mutation 'R4038:Gm4787'

313805

Institutional Source

Beutler Lab

Gene Symbol

Gm4787

Ensembl Gene

ENSMUSG00000072974

Gene Name

predicted gene 4787

Synonyms

MMRRC Submission

040965-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.066) question?

Stock #

R4038 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

81376991-81379464 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 81378358 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Phenylalanine to Tyrosine at position 342 (F342Y)

Ref Sequence

ENSEMBL: ENSMUSP00000077390 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000062182] [ENSMUST00000110340] [ENSMUST00000164386] [ENSMUST00000166723]

AlphaFold

B2RUD9

Predicted Effect

probably damaging
Transcript: ENSMUST00000062182
AA Change: F342Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000077390
Gene: ENSMUSG00000072974
AA Change: F342Y

Domain	Start	End	E-Value	Type
signal peptide	1	33	N/A	INTRINSIC
Pfam:Pep_M12B_propep	46	163	1.5e-19	PFAM
Pfam:Reprolysin	213	406	4.6e-18	PFAM
DISIN	425	500	2e-33	SMART
ACR	501	644	2.83e-53	SMART
transmembrane domain	714	736	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000110340

SMART Domains

Protein: ENSMUSP00000105969
Gene: ENSMUSG00000091803

Domain	Start	End	E-Value	Type
Pfam:COX16	16	74	6.6e-17	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000164386

SMART Domains

Protein: ENSMUSP00000132941
Gene: ENSMUSG00000021139

Domain	Start	End	E-Value	Type
PDZ	21	100	6.16e-24	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000166723

SMART Domains

Protein: ENSMUSP00000130935
Gene: ENSMUSG00000091803

Domain	Start	End	E-Value	Type
Pfam:COX16	16	73	6.9e-16	PFAM

Meta Mutation Damage Score

0.6467

Coding Region Coverage

1x: 99.1%
3x: 98.4%
10x: 96.7%
20x: 93.1%

Validation Efficiency

93% (39/42)

Allele List at MGI

Other mutations in this stock

Total: 38 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Ate1	A	G	7: 130,504,765	S282P	probably damaging	Het
Cacna1d	T	A	14: 30,066,083	Q1610L	probably damaging	Het
Carmil2	C	A	8: 105,695,407	R1103S	probably damaging	Het
Clca3a1	T	A	3: 144,755,233	Y219F	probably benign	Het
Creb3l3	A	G	10: 81,089,338	V224A	probably benign	Het
Crnkl1	T	A	2: 145,932,327	D72V	possibly damaging	Het
Dhcr24	T	C	4: 106,573,878	F255L	probably benign	Het
Eef2kmt	A	T	16: 5,245,271	V335D	probably damaging	Het
Elp2	T	A	18: 24,634,348	W696R	probably damaging	Het
Glb1l3	A	C	9: 26,829,047	M329R	probably damaging	Het
Gpr137c	C	A	14: 45,220,230	L80I	probably damaging	Het
Gpr83	A	G	9: 14,860,777	I82V	possibly damaging	Het
Greb1l	C	T	18: 10,515,209	T558I	possibly damaging	Het
Hnrnpul2	T	A	19: 8,823,227		probably benign	Het
Hspa2	T	C	12: 76,405,768	V412A	probably damaging	Het
Iqcd	T	C	5: 120,602,522	V306A	probably damaging	Het
Lmod3	T	C	6: 97,248,314	N182S	probably benign	Het
Metrn	T	C	17: 25,795,010	T281A	probably benign	Het
Mid1-ps1	G	A	Y: 90,762,294		noncoding transcript	Het
Mmachc	T	A	4: 116,706,018	T47S	probably damaging	Het
Nfia	C	A	4: 98,020,837	R277S	probably damaging	Het
Olfr1158	T	A	2: 87,990,918	I269N	possibly damaging	Het
Pcdha8	T	C	18: 36,992,861	M132T	probably benign	Het
Prkaa2	T	C	4: 105,051,247	N144D	probably damaging	Het
Ptprf	C	T	4: 118,257,608	R150H	probably damaging	Het
Sfmbt1	T	G	14: 30,787,492	D309E	probably damaging	Het
Skint5	G	T	4: 113,885,814	T352K	unknown	Het
Slc16a10	G	C	10: 40,056,624	H314D	possibly damaging	Het
Slc28a2	C	A	2: 122,454,515	A328E	probably benign	Het
Ssc4d	C	A	5: 135,970,316	W11L	possibly damaging	Het
Sycp2	C	A	2: 178,380,927	M470I	possibly damaging	Het
Tfap2c	A	T	2: 172,556,190	S413C	probably damaging	Het
Unc13c	A	G	9: 73,533,906		probably null	Het
Vmn1r218	T	C	13: 23,136,801	V26A	possibly damaging	Het
Wipf3	G	A	6: 54,481,828	G56D	probably damaging	Het
Wiz	T	C	17: 32,359,224	E429G	probably damaging	Het
Zer1	T	C	2: 30,107,523	N457S	probably damaging	Het
Zfp931	T	A	2: 178,067,984	Q203L	possibly damaging	Het

Other mutations in Gm4787

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01719:Gm4787	APN	12	81377174	missense	possibly damaging	0.50
IGL01916:Gm4787	APN	12	81377444	missense	probably benign	0.36
IGL02193:Gm4787	APN	12	81378528	missense	probably benign	0.02
IGL02623:Gm4787	APN	12	81378728	missense	probably damaging	1.00
IGL02681:Gm4787	APN	12	81378769	missense	possibly damaging	0.88
IGL03257:Gm4787	APN	12	81378052	missense	probably damaging	1.00
IGL03410:Gm4787	APN	12	81379174	missense	probably damaging	1.00
F5770:Gm4787	UTSW	12	81377567	nonsense	probably null
PIT4362001:Gm4787	UTSW	12	81377175	missense	probably benign
R0070:Gm4787	UTSW	12	81379066	missense	probably damaging	1.00
R0128:Gm4787	UTSW	12	81377747	nonsense	probably null
R0220:Gm4787	UTSW	12	81378648	missense	probably damaging	0.98
R0304:Gm4787	UTSW	12	81378934	missense	probably damaging	1.00
R0513:Gm4787	UTSW	12	81378312	missense	probably benign	0.03
R1761:Gm4787	UTSW	12	81377176	missense	probably benign	0.02
R1809:Gm4787	UTSW	12	81378529	missense	possibly damaging	0.91
R1853:Gm4787	UTSW	12	81378334	missense	probably damaging	1.00
R1854:Gm4787	UTSW	12	81378334	missense	probably damaging	1.00
R2030:Gm4787	UTSW	12	81378770	missense	probably damaging	1.00
R2063:Gm4787	UTSW	12	81378920	missense	probably benign	0.39
R2112:Gm4787	UTSW	12	81377833	missense	probably damaging	1.00
R2140:Gm4787	UTSW	12	81378562	missense	probably benign	0.03
R2151:Gm4787	UTSW	12	81377219	missense	probably benign	0.00
R2152:Gm4787	UTSW	12	81377219	missense	probably benign	0.00
R2342:Gm4787	UTSW	12	81378758	missense	possibly damaging	0.91
R2504:Gm4787	UTSW	12	81379137	missense	possibly damaging	0.93
R4604:Gm4787	UTSW	12	81379213	missense	probably benign	0.17
R4748:Gm4787	UTSW	12	81378056	missense	probably damaging	1.00
R4750:Gm4787	UTSW	12	81378367	missense	possibly damaging	0.95
R4928:Gm4787	UTSW	12	81378838	missense	probably benign	0.03
R4960:Gm4787	UTSW	12	81379316	missense	probably damaging	0.99
R4974:Gm4787	UTSW	12	81377629	missense	probably damaging	0.99
R5028:Gm4787	UTSW	12	81377830	missense	probably benign	0.01
R5029:Gm4787	UTSW	12	81377830	missense	probably benign	0.01
R5031:Gm4787	UTSW	12	81377830	missense	probably benign	0.01
R5098:Gm4787	UTSW	12	81377830	missense	probably benign	0.01
R5099:Gm4787	UTSW	12	81377830	missense	probably benign	0.01
R5100:Gm4787	UTSW	12	81377830	missense	probably benign	0.01
R5101:Gm4787	UTSW	12	81377830	missense	probably benign	0.01
R5135:Gm4787	UTSW	12	81377830	missense	probably benign	0.01
R5152:Gm4787	UTSW	12	81378677	missense	probably benign	0.02
R5180:Gm4787	UTSW	12	81377830	missense	probably benign	0.01
R5220:Gm4787	UTSW	12	81377830	missense	probably benign	0.01
R5257:Gm4787	UTSW	12	81377830	missense	probably benign	0.01
R5258:Gm4787	UTSW	12	81377830	missense	probably benign	0.01
R5297:Gm4787	UTSW	12	81377830	missense	probably benign	0.01
R5324:Gm4787	UTSW	12	81377830	missense	probably benign	0.01
R5325:Gm4787	UTSW	12	81377830	missense	probably benign	0.01
R5355:Gm4787	UTSW	12	81377465	nonsense	probably null
R5364:Gm4787	UTSW	12	81377830	missense	probably benign	0.01
R5396:Gm4787	UTSW	12	81377830	missense	probably benign	0.01
R5397:Gm4787	UTSW	12	81377830	missense	probably benign	0.01
R5398:Gm4787	UTSW	12	81377830	missense	probably benign	0.01
R5514:Gm4787	UTSW	12	81378328	missense	possibly damaging	0.90
R5634:Gm4787	UTSW	12	81377830	missense	probably benign	0.01
R5666:Gm4787	UTSW	12	81378031	missense	probably benign	0.23
R5670:Gm4787	UTSW	12	81378031	missense	probably benign	0.23
R5787:Gm4787	UTSW	12	81377830	missense	probably benign	0.01
R5788:Gm4787	UTSW	12	81377830	missense	probably benign	0.01
R6354:Gm4787	UTSW	12	81377981	missense	probably damaging	1.00
R6932:Gm4787	UTSW	12	81379200	missense	probably benign	0.04
R7120:Gm4787	UTSW	12	81378486	missense	probably benign	0.00
R7237:Gm4787	UTSW	12	81377668	missense	probably damaging	0.99
R7937:Gm4787	UTSW	12	81377905	missense	probably benign	0.01
R8022:Gm4787	UTSW	12	81377720	missense	possibly damaging	0.94
R8140:Gm4787	UTSW	12	81378151	missense	probably benign	0.00
R8314:Gm4787	UTSW	12	81379135	missense	probably damaging	1.00
R8480:Gm4787	UTSW	12	81377506	missense	probably damaging	1.00
R8498:Gm4787	UTSW	12	81379066	missense	probably damaging	1.00
R8515:Gm4787	UTSW	12	81377269	missense	probably benign	0.00
R9103:Gm4787	UTSW	12	81378715	missense	probably benign	0.06
R9457:Gm4787	UTSW	12	81379246	missense	probably damaging	1.00
R9557:Gm4787	UTSW	12	81379300	nonsense	probably null
V7580:Gm4787	UTSW	12	81377567	nonsense	probably null
V7581:Gm4787	UTSW	12	81377567	nonsense	probably null
V7582:Gm4787	UTSW	12	81377567	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- ATGCAAGGATCCCAACCATG -3'
(R):5'- TTGGAATGACAAGGACCACTAC -3'

Sequencing Primer
(F):5'- GGATCCTCATATGTAGCACATCATGG -3'
(R):5'- TGACAAGGACCACTACTCAATTTC -3'

Posted On

2015-04-30