Incidental Mutation 'R4038:Gpr137c'
ID313809
Institutional Source Beutler Lab
Gene Symbol Gpr137c
Ensembl Gene ENSMUSG00000049092
Gene NameG protein-coupled receptor 137C
SynonymsLOC380893, 6330416L11Rik, TM7SF1L2
MMRRC Submission 040965-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.068) question?
Stock #R4038 (G1)
Quality Score155
Status Validated
Chromosome14
Chromosomal Location45219717-45282725 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 45220230 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Isoleucine at position 80 (L80I)
Ref Sequence ENSEMBL: ENSMUSP00000154316 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022377] [ENSMUST00000123879] [ENSMUST00000128484] [ENSMUST00000139526] [ENSMUST00000143609] [ENSMUST00000146150] [ENSMUST00000147853] [ENSMUST00000147957] [ENSMUST00000153383] [ENSMUST00000226879] [ENSMUST00000227009] [ENSMUST00000227056] [ENSMUST00000227086]
Predicted Effect probably benign
Transcript: ENSMUST00000022377
SMART Domains Protein: ENSMUSP00000022377
Gene: ENSMUSG00000021830

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
low complexity region 298 308 N/A INTRINSIC
low complexity region 354 367 N/A INTRINSIC
Pfam:Thioredoxin 394 496 1.9e-12 PFAM
Pfam:Thioredoxin_6 534 723 2.3e-28 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123118
Predicted Effect probably benign
Transcript: ENSMUST00000123879
SMART Domains Protein: ENSMUSP00000123023
Gene: ENSMUSG00000021830

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
low complexity region 298 308 N/A INTRINSIC
low complexity region 354 367 N/A INTRINSIC
Pfam:Thioredoxin 394 496 1.9e-12 PFAM
Pfam:Thioredoxin_6 534 723 2.3e-28 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000128484
Predicted Effect probably benign
Transcript: ENSMUST00000139526
SMART Domains Protein: ENSMUSP00000120287
Gene: ENSMUSG00000021830

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
low complexity region 298 308 N/A INTRINSIC
low complexity region 354 367 N/A INTRINSIC
Pfam:Thioredoxin 394 496 1e-12 PFAM
Pfam:Thioredoxin_6 534 723 7.3e-30 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000143609
SMART Domains Protein: ENSMUSP00000122128
Gene: ENSMUSG00000021830

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000146150
AA Change: L80I

PolyPhen 2 Score 0.519 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000120015
Gene: ENSMUSG00000049092
AA Change: L80I

DomainStartEndE-ValueType
low complexity region 4 17 N/A INTRINSIC
low complexity region 23 39 N/A INTRINSIC
transmembrane domain 44 66 N/A INTRINSIC
transmembrane domain 78 100 N/A INTRINSIC
Blast:G_alpha 121 286 9e-17 BLAST
transmembrane domain 294 316 N/A INTRINSIC
low complexity region 376 389 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000147853
Predicted Effect possibly damaging
Transcript: ENSMUST00000147957
AA Change: L80I

PolyPhen 2 Score 0.519 (Sensitivity: 0.88; Specificity: 0.90)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150648
Predicted Effect probably benign
Transcript: ENSMUST00000153383
Predicted Effect probably benign
Transcript: ENSMUST00000226879
Predicted Effect unknown
Transcript: ENSMUST00000226915
AA Change: P20H
Predicted Effect probably damaging
Transcript: ENSMUST00000227009
AA Change: L80I

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)
Predicted Effect probably damaging
Transcript: ENSMUST00000227056
AA Change: L72I

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)
Predicted Effect probably damaging
Transcript: ENSMUST00000227086
AA Change: L80I

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)
Meta Mutation Damage Score 0.1563 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 93.1%
Validation Efficiency 93% (39/42)
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ate1 A G 7: 130,504,765 S282P probably damaging Het
Cacna1d T A 14: 30,066,083 Q1610L probably damaging Het
Carmil2 C A 8: 105,695,407 R1103S probably damaging Het
Clca3a1 T A 3: 144,755,233 Y219F probably benign Het
Creb3l3 A G 10: 81,089,338 V224A probably benign Het
Crnkl1 T A 2: 145,932,327 D72V possibly damaging Het
Dhcr24 T C 4: 106,573,878 F255L probably benign Het
Eef2kmt A T 16: 5,245,271 V335D probably damaging Het
Elp2 T A 18: 24,634,348 W696R probably damaging Het
Glb1l3 A C 9: 26,829,047 M329R probably damaging Het
Gm4787 A T 12: 81,378,358 F342Y probably damaging Het
Gpr83 A G 9: 14,860,777 I82V possibly damaging Het
Greb1l C T 18: 10,515,209 T558I possibly damaging Het
Hnrnpul2 T A 19: 8,823,227 probably benign Het
Hspa2 T C 12: 76,405,768 V412A probably damaging Het
Iqcd T C 5: 120,602,522 V306A probably damaging Het
Lmod3 T C 6: 97,248,314 N182S probably benign Het
Metrn T C 17: 25,795,010 T281A probably benign Het
Mid1-ps1 G A Y: 90,762,294 noncoding transcript Het
Mmachc T A 4: 116,706,018 T47S probably damaging Het
Nfia C A 4: 98,020,837 R277S probably damaging Het
Olfr1158 T A 2: 87,990,918 I269N possibly damaging Het
Pcdha8 T C 18: 36,992,861 M132T probably benign Het
Prkaa2 T C 4: 105,051,247 N144D probably damaging Het
Ptprf C T 4: 118,257,608 R150H probably damaging Het
Sfmbt1 T G 14: 30,787,492 D309E probably damaging Het
Skint5 G T 4: 113,885,814 T352K unknown Het
Slc16a10 G C 10: 40,056,624 H314D possibly damaging Het
Slc28a2 C A 2: 122,454,515 A328E probably benign Het
Ssc4d C A 5: 135,970,316 W11L possibly damaging Het
Sycp2 C A 2: 178,380,927 M470I possibly damaging Het
Tfap2c A T 2: 172,556,190 S413C probably damaging Het
Unc13c A G 9: 73,533,906 probably null Het
Vmn1r218 T C 13: 23,136,801 V26A possibly damaging Het
Wipf3 G A 6: 54,481,828 G56D probably damaging Het
Wiz T C 17: 32,359,224 E429G probably damaging Het
Zer1 T C 2: 30,107,523 N457S probably damaging Het
Zfp931 T A 2: 178,067,984 Q203L possibly damaging Het
Other mutations in Gpr137c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00478:Gpr137c APN 14 45278745 missense probably damaging 0.97
IGL02167:Gpr137c APN 14 45279955 missense probably damaging 0.98
IGL02203:Gpr137c APN 14 45277487 missense possibly damaging 0.86
IGL02960:Gpr137c APN 14 45246433 missense possibly damaging 0.92
R0731:Gpr137c UTSW 14 45246349 missense probably damaging 1.00
R1162:Gpr137c UTSW 14 45244158 missense possibly damaging 0.89
R1245:Gpr137c UTSW 14 45279065 utr 3 prime probably benign
R1983:Gpr137c UTSW 14 45279971 missense probably benign 0.01
R2060:Gpr137c UTSW 14 45244159 missense probably damaging 1.00
R2428:Gpr137c UTSW 14 45278963 missense probably damaging 1.00
R3034:Gpr137c UTSW 14 45220276 missense probably damaging 0.99
R3911:Gpr137c UTSW 14 45278935 missense probably benign 0.31
R4037:Gpr137c UTSW 14 45220230 missense probably damaging 0.99
R4213:Gpr137c UTSW 14 45246508 missense probably damaging 0.99
R4986:Gpr137c UTSW 14 45246286 critical splice acceptor site probably null
R5521:Gpr137c UTSW 14 45278694 missense possibly damaging 0.92
R6028:Gpr137c UTSW 14 45277481 missense probably damaging 0.96
R7117:Gpr137c UTSW 14 45279027 missense probably damaging 1.00
R7238:Gpr137c UTSW 14 45278691 missense probably damaging 1.00
R7365:Gpr137c UTSW 14 45279014 missense probably damaging 1.00
X0027:Gpr137c UTSW 14 45278669 missense probably benign 0.14
Predicted Primers PCR Primer
(F):5'- CCTCATGAGGGTATCAGTGTCC -3'
(R):5'- TCTGCCAGGTAGAGGTTGAG -3'

Sequencing Primer
(F):5'- TATCAGTGTCCGGGCCG -3'
(R):5'- CCAGGTAGAGGTTGAGGAGAC -3'
Posted On2015-04-30