Incidental Mutation 'R4038:Metrn'
ID313812
Institutional Source Beutler Lab
Gene Symbol Metrn
Ensembl Gene ENSMUSG00000002274
Gene Namemeteorin, glial cell differentiation regulator
Synonyms1810034B16Rik
MMRRC Submission 040965-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.367) question?
Stock #R4038 (G1)
Quality Score188
Status Validated
Chromosome17
Chromosomal Location25794571-25797136 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 25795010 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 281 (T281A)
Ref Sequence ENSEMBL: ENSMUSP00000127275 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002344] [ENSMUST00000072735] [ENSMUST00000095500] [ENSMUST00000165838]
Predicted Effect probably benign
Transcript: ENSMUST00000002344
AA Change: T281A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000002344
Gene: ENSMUSG00000002274
AA Change: T281A

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000072735
SMART Domains Protein: ENSMUSP00000072518
Gene: ENSMUSG00000057411

DomainStartEndE-ValueType
transmembrane domain 20 42 N/A INTRINSIC
SCOP:d1f3la_ 65 141 2e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000095500
SMART Domains Protein: ENSMUSP00000093155
Gene: ENSMUSG00000071202

DomainStartEndE-ValueType
Pfam:DUF4472 63 190 5.5e-23 PFAM
coiled coil region 364 408 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000165838
AA Change: T281A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000127275
Gene: ENSMUSG00000002274
AA Change: T281A

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000180868
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 93.1%
Validation Efficiency 93% (39/42)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Meteorin regulates glial cell differentiation and promotes the formation of axonal networks during neurogenesis (Nishino et al., 2004 [PubMed 15085178]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ate1 A G 7: 130,504,765 S282P probably damaging Het
Cacna1d T A 14: 30,066,083 Q1610L probably damaging Het
Carmil2 C A 8: 105,695,407 R1103S probably damaging Het
Clca3a1 T A 3: 144,755,233 Y219F probably benign Het
Creb3l3 A G 10: 81,089,338 V224A probably benign Het
Crnkl1 T A 2: 145,932,327 D72V possibly damaging Het
Dhcr24 T C 4: 106,573,878 F255L probably benign Het
Eef2kmt A T 16: 5,245,271 V335D probably damaging Het
Elp2 T A 18: 24,634,348 W696R probably damaging Het
Glb1l3 A C 9: 26,829,047 M329R probably damaging Het
Gm4787 A T 12: 81,378,358 F342Y probably damaging Het
Gpr137c C A 14: 45,220,230 L80I probably damaging Het
Gpr83 A G 9: 14,860,777 I82V possibly damaging Het
Greb1l C T 18: 10,515,209 T558I possibly damaging Het
Hnrnpul2 T A 19: 8,823,227 probably benign Het
Hspa2 T C 12: 76,405,768 V412A probably damaging Het
Iqcd T C 5: 120,602,522 V306A probably damaging Het
Lmod3 T C 6: 97,248,314 N182S probably benign Het
Mid1-ps1 G A Y: 90,762,294 noncoding transcript Het
Mmachc T A 4: 116,706,018 T47S probably damaging Het
Nfia C A 4: 98,020,837 R277S probably damaging Het
Olfr1158 T A 2: 87,990,918 I269N possibly damaging Het
Pcdha8 T C 18: 36,992,861 M132T probably benign Het
Prkaa2 T C 4: 105,051,247 N144D probably damaging Het
Ptprf C T 4: 118,257,608 R150H probably damaging Het
Sfmbt1 T G 14: 30,787,492 D309E probably damaging Het
Skint5 G T 4: 113,885,814 T352K unknown Het
Slc16a10 G C 10: 40,056,624 H314D possibly damaging Het
Slc28a2 C A 2: 122,454,515 A328E probably benign Het
Ssc4d C A 5: 135,970,316 W11L possibly damaging Het
Sycp2 C A 2: 178,380,927 M470I possibly damaging Het
Tfap2c A T 2: 172,556,190 S413C probably damaging Het
Unc13c A G 9: 73,533,906 probably null Het
Vmn1r218 T C 13: 23,136,801 V26A possibly damaging Het
Wipf3 G A 6: 54,481,828 G56D probably damaging Het
Wiz T C 17: 32,359,224 E429G probably damaging Het
Zer1 T C 2: 30,107,523 N457S probably damaging Het
Zfp931 T A 2: 178,067,984 Q203L possibly damaging Het
Other mutations in Metrn
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0008:Metrn UTSW 17 25796505 missense possibly damaging 0.94
R0280:Metrn UTSW 17 25795135 missense probably benign 0.08
R0729:Metrn UTSW 17 25796228 splice site probably benign
R1523:Metrn UTSW 17 25794977 makesense probably null
R2119:Metrn UTSW 17 25795223 missense probably benign 0.03
R2146:Metrn UTSW 17 25796627 missense probably damaging 0.99
R4036:Metrn UTSW 17 25795010 missense probably benign
R4037:Metrn UTSW 17 25795010 missense probably benign
R4230:Metrn UTSW 17 25796941 unclassified probably benign
R5074:Metrn UTSW 17 25796639 missense probably damaging 1.00
R5259:Metrn UTSW 17 25796540 missense probably damaging 1.00
R5686:Metrn UTSW 17 25795217 missense probably damaging 1.00
R5744:Metrn UTSW 17 25795237 missense probably damaging 1.00
R7707:Metrn UTSW 17 25795410 missense probably benign 0.17
R8108:Metrn UTSW 17 25795030 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AAGACCATGACTACAGTGGC -3'
(R):5'- AGACACTGCCACTGTTCAAG -3'

Sequencing Primer
(F):5'- ACCATGACTACAGTGGCTGGTATG -3'
(R):5'- CACTGCCACTGTTCAAGGAAGG -3'
Posted On2015-04-30