Incidental Mutation 'R4038:Wiz'
ID313814
Institutional Source Beutler Lab
Gene Symbol Wiz
Ensembl Gene ENSMUSG00000024050
Gene Namewidely-interspaced zinc finger motifs
Synonyms
MMRRC Submission 040965-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4038 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location32354055-32389401 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 32359224 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 429 (E429G)
Ref Sequence ENSEMBL: ENSMUSP00000069443 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000064694] [ENSMUST00000087703] [ENSMUST00000163107] [ENSMUST00000165912] [ENSMUST00000169488] [ENSMUST00000170617]
Predicted Effect probably damaging
Transcript: ENSMUST00000064694
AA Change: E429G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000069443
Gene: ENSMUSG00000024050
AA Change: E429G

DomainStartEndE-ValueType
low complexity region 27 35 N/A INTRINSIC
ZnF_C2H2 74 96 8.67e-1 SMART
ZnF_C2H2 175 197 4.72e-2 SMART
ZnF_C2H2 348 370 1.67e-2 SMART
low complexity region 401 412 N/A INTRINSIC
low complexity region 439 458 N/A INTRINSIC
ZnF_C2H2 532 554 1.67e-2 SMART
low complexity region 576 588 N/A INTRINSIC
low complexity region 607 623 N/A INTRINSIC
ZnF_C2H2 702 724 1.41e0 SMART
low complexity region 784 793 N/A INTRINSIC
low complexity region 869 887 N/A INTRINSIC
ZnF_C2H2 901 927 1.06e2 SMART
low complexity region 936 956 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000087703
AA Change: E429G

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000084993
Gene: ENSMUSG00000024050
AA Change: E429G

DomainStartEndE-ValueType
low complexity region 27 35 N/A INTRINSIC
ZnF_C2H2 74 96 8.67e-1 SMART
ZnF_C2H2 175 197 4.72e-2 SMART
ZnF_C2H2 348 370 1.67e-2 SMART
low complexity region 401 412 N/A INTRINSIC
low complexity region 439 458 N/A INTRINSIC
ZnF_C2H2 531 553 1.67e-2 SMART
low complexity region 575 587 N/A INTRINSIC
low complexity region 606 622 N/A INTRINSIC
ZnF_C2H2 701 723 1.41e0 SMART
low complexity region 783 792 N/A INTRINSIC
low complexity region 868 886 N/A INTRINSIC
ZnF_C2H2 900 926 1.06e2 SMART
low complexity region 935 955 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000163107
SMART Domains Protein: ENSMUSP00000127943
Gene: ENSMUSG00000024050

DomainStartEndE-ValueType
low complexity region 27 35 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000165912
SMART Domains Protein: ENSMUSP00000127651
Gene: ENSMUSG00000024050

DomainStartEndE-ValueType
low complexity region 27 35 N/A INTRINSIC
ZnF_C2H2 74 96 8.67e-1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000168943
Predicted Effect probably damaging
Transcript: ENSMUST00000169488
AA Change: E438G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000126253
Gene: ENSMUSG00000024050
AA Change: E438G

DomainStartEndE-ValueType
low complexity region 8 17 N/A INTRINSIC
ZnF_C2H2 54 76 4.72e-2 SMART
ZnF_C2H2 227 249 3.52e-1 SMART
low complexity region 294 318 N/A INTRINSIC
ZnF_C2H2 357 379 1.67e-2 SMART
low complexity region 410 421 N/A INTRINSIC
low complexity region 448 467 N/A INTRINSIC
ZnF_C2H2 541 563 1.67e-2 SMART
low complexity region 585 597 N/A INTRINSIC
low complexity region 616 632 N/A INTRINSIC
ZnF_C2H2 711 733 1.41e0 SMART
low complexity region 793 802 N/A INTRINSIC
low complexity region 878 896 N/A INTRINSIC
ZnF_C2H2 910 936 1.06e2 SMART
low complexity region 945 965 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000169741
Predicted Effect probably benign
Transcript: ENSMUST00000170617
SMART Domains Protein: ENSMUSP00000130517
Gene: ENSMUSG00000024050

DomainStartEndE-ValueType
low complexity region 27 35 N/A INTRINSIC
Meta Mutation Damage Score 0.0984 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 93.1%
Validation Efficiency 93% (39/42)
MGI Phenotype PHENOTYPE: Homozygous mutant mice die prenatally. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ate1 A G 7: 130,504,765 S282P probably damaging Het
Cacna1d T A 14: 30,066,083 Q1610L probably damaging Het
Carmil2 C A 8: 105,695,407 R1103S probably damaging Het
Clca3a1 T A 3: 144,755,233 Y219F probably benign Het
Creb3l3 A G 10: 81,089,338 V224A probably benign Het
Crnkl1 T A 2: 145,932,327 D72V possibly damaging Het
Dhcr24 T C 4: 106,573,878 F255L probably benign Het
Eef2kmt A T 16: 5,245,271 V335D probably damaging Het
Elp2 T A 18: 24,634,348 W696R probably damaging Het
Glb1l3 A C 9: 26,829,047 M329R probably damaging Het
Gm4787 A T 12: 81,378,358 F342Y probably damaging Het
Gpr137c C A 14: 45,220,230 L80I probably damaging Het
Gpr83 A G 9: 14,860,777 I82V possibly damaging Het
Greb1l C T 18: 10,515,209 T558I possibly damaging Het
Hnrnpul2 T A 19: 8,823,227 probably benign Het
Hspa2 T C 12: 76,405,768 V412A probably damaging Het
Iqcd T C 5: 120,602,522 V306A probably damaging Het
Lmod3 T C 6: 97,248,314 N182S probably benign Het
Metrn T C 17: 25,795,010 T281A probably benign Het
Mid1-ps1 G A Y: 90,762,294 noncoding transcript Het
Mmachc T A 4: 116,706,018 T47S probably damaging Het
Nfia C A 4: 98,020,837 R277S probably damaging Het
Olfr1158 T A 2: 87,990,918 I269N possibly damaging Het
Pcdha8 T C 18: 36,992,861 M132T probably benign Het
Prkaa2 T C 4: 105,051,247 N144D probably damaging Het
Ptprf C T 4: 118,257,608 R150H probably damaging Het
Sfmbt1 T G 14: 30,787,492 D309E probably damaging Het
Skint5 G T 4: 113,885,814 T352K unknown Het
Slc16a10 G C 10: 40,056,624 H314D possibly damaging Het
Slc28a2 C A 2: 122,454,515 A328E probably benign Het
Ssc4d C A 5: 135,970,316 W11L possibly damaging Het
Sycp2 C A 2: 178,380,927 M470I possibly damaging Het
Tfap2c A T 2: 172,556,190 S413C probably damaging Het
Unc13c A G 9: 73,533,906 probably null Het
Vmn1r218 T C 13: 23,136,801 V26A possibly damaging Het
Wipf3 G A 6: 54,481,828 G56D probably damaging Het
Zer1 T C 2: 30,107,523 N457S probably damaging Het
Zfp931 T A 2: 178,067,984 Q203L possibly damaging Het
Other mutations in Wiz
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02145:Wiz APN 17 32356919 missense probably benign 0.43
IGL02176:Wiz APN 17 32356902 missense probably damaging 0.96
IGL02212:Wiz APN 17 32368135 missense probably damaging 1.00
IGL02213:Wiz APN 17 32367860 missense probably benign 0.03
IGL02616:Wiz APN 17 32359469 missense probably damaging 1.00
IGL02654:Wiz APN 17 32359350 missense probably damaging 1.00
IGL02833:Wiz APN 17 32357879 missense probably damaging 1.00
IGL03032:Wiz APN 17 32356558 missense probably benign
E0370:Wiz UTSW 17 32355118 missense probably damaging 1.00
IGL03138:Wiz UTSW 17 32359119 missense probably damaging 1.00
PIT4494001:Wiz UTSW 17 32361931 missense probably damaging 1.00
R0197:Wiz UTSW 17 32356441 missense probably damaging 1.00
R0207:Wiz UTSW 17 32357033 missense probably damaging 1.00
R0701:Wiz UTSW 17 32356441 missense probably damaging 1.00
R0883:Wiz UTSW 17 32356441 missense probably damaging 1.00
R1055:Wiz UTSW 17 32387642 missense probably damaging 0.99
R1968:Wiz UTSW 17 32359372 missense probably damaging 1.00
R2225:Wiz UTSW 17 32356925 missense probably damaging 1.00
R2423:Wiz UTSW 17 32361885 missense probably damaging 1.00
R2860:Wiz UTSW 17 32361706 missense probably damaging 1.00
R2861:Wiz UTSW 17 32361706 missense probably damaging 1.00
R3056:Wiz UTSW 17 32357697 missense probably benign 0.01
R3755:Wiz UTSW 17 32359132 missense probably damaging 1.00
R3885:Wiz UTSW 17 32357038 missense possibly damaging 0.48
R3933:Wiz UTSW 17 32357898 missense probably damaging 1.00
R4118:Wiz UTSW 17 32369357 utr 3 prime probably benign
R4181:Wiz UTSW 17 32367985 missense probably damaging 1.00
R4651:Wiz UTSW 17 32357681 missense probably damaging 1.00
R4822:Wiz UTSW 17 32356437 nonsense probably null
R4891:Wiz UTSW 17 32357628 missense possibly damaging 0.85
R4923:Wiz UTSW 17 32361596 missense probably benign 0.01
R5014:Wiz UTSW 17 32359366 missense probably damaging 1.00
R5194:Wiz UTSW 17 32377848 utr 3 prime probably benign
R5254:Wiz UTSW 17 32378496 splice site probably benign
R5944:Wiz UTSW 17 32357697 missense probably benign 0.01
R6015:Wiz UTSW 17 32387600 missense probably damaging 0.99
R6263:Wiz UTSW 17 32360443 intron probably null
R6571:Wiz UTSW 17 32359324 missense probably damaging 1.00
R6823:Wiz UTSW 17 32360421 missense probably damaging 0.99
R7014:Wiz UTSW 17 32361866 missense probably damaging 0.98
R7051:Wiz UTSW 17 32361533 missense probably damaging 1.00
R7144:Wiz UTSW 17 32357628 missense possibly damaging 0.85
R7221:Wiz UTSW 17 32359165 missense probably benign 0.03
R7260:Wiz UTSW 17 32359111 missense probably damaging 0.99
R7453:Wiz UTSW 17 32379075 missense probably benign 0.00
R7849:Wiz UTSW 17 32357786 missense probably benign 0.26
R7932:Wiz UTSW 17 32357786 missense probably benign 0.26
U24488:Wiz UTSW 17 32387675 missense probably damaging 1.00
X0026:Wiz UTSW 17 32387758 start codon destroyed probably null 0.94
Z1176:Wiz UTSW 17 32361495
Z1177:Wiz UTSW 17 32357778
Predicted Primers PCR Primer
(F):5'- CTCTCATGTGTTCAGGCTTCAG -3'
(R):5'- GCCAACAAGAGATATCCGCTG -3'

Sequencing Primer
(F):5'- CAGGCTTCAGTTTCTTGGGCAG -3'
(R):5'- CAAGAGATATCCGCTGTGAGTTC -3'
Posted On2015-04-30