Incidental Mutation 'R4038:Elp2'
ID313817
Institutional Source Beutler Lab
Gene Symbol Elp2
Ensembl Gene ENSMUSG00000024271
Gene Nameelongator acetyltransferase complex subunit 2
SynonymsStatip1, StIP1, Stat3-interacting protein
MMRRC Submission 040965-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.958) question?
Stock #R4038 (G1)
Quality Score225
Status Validated
Chromosome18
Chromosomal Location24603961-24638830 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 24634348 bp
ZygosityHeterozygous
Amino Acid Change Tryptophan to Arginine at position 696 (W696R)
Ref Sequence ENSEMBL: ENSMUSP00000025120 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025120]
Predicted Effect probably damaging
Transcript: ENSMUST00000025120
AA Change: W696R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000025120
Gene: ENSMUSG00000024271
AA Change: W696R

DomainStartEndE-ValueType
WD40 47 91 1.06e-3 SMART
WD40 94 143 2.24e-2 SMART
WD40 196 237 4.69e-5 SMART
WD40 271 319 2.44e-3 SMART
Blast:WD40 329 368 1e-20 BLAST
WD40 376 415 2.12e-3 SMART
WD40 429 467 1.71e1 SMART
WD40 556 600 7.43e-1 SMART
WD40 603 642 1.93e-6 SMART
WD40 661 697 1.55e-5 SMART
Blast:WD40 709 753 7e-21 BLAST
WD40 766 825 1.92e0 SMART
Meta Mutation Damage Score 0.9649 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 93.1%
Validation Efficiency 93% (39/42)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a core subunit of the elongator complex, a histone acetyltransferase complex that associates with RNA polymerase II. In addition to histone acetylation, the encoded protein effects transcriptional elongation and may help remodel chromatin. [provided by RefSeq, May 2016]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ate1 A G 7: 130,504,765 S282P probably damaging Het
Cacna1d T A 14: 30,066,083 Q1610L probably damaging Het
Carmil2 C A 8: 105,695,407 R1103S probably damaging Het
Clca3a1 T A 3: 144,755,233 Y219F probably benign Het
Creb3l3 A G 10: 81,089,338 V224A probably benign Het
Crnkl1 T A 2: 145,932,327 D72V possibly damaging Het
Dhcr24 T C 4: 106,573,878 F255L probably benign Het
Eef2kmt A T 16: 5,245,271 V335D probably damaging Het
Glb1l3 A C 9: 26,829,047 M329R probably damaging Het
Gm4787 A T 12: 81,378,358 F342Y probably damaging Het
Gpr137c C A 14: 45,220,230 L80I probably damaging Het
Gpr83 A G 9: 14,860,777 I82V possibly damaging Het
Greb1l C T 18: 10,515,209 T558I possibly damaging Het
Hnrnpul2 T A 19: 8,823,227 probably benign Het
Hspa2 T C 12: 76,405,768 V412A probably damaging Het
Iqcd T C 5: 120,602,522 V306A probably damaging Het
Lmod3 T C 6: 97,248,314 N182S probably benign Het
Metrn T C 17: 25,795,010 T281A probably benign Het
Mid1-ps1 G A Y: 90,762,294 noncoding transcript Het
Mmachc T A 4: 116,706,018 T47S probably damaging Het
Nfia C A 4: 98,020,837 R277S probably damaging Het
Olfr1158 T A 2: 87,990,918 I269N possibly damaging Het
Pcdha8 T C 18: 36,992,861 M132T probably benign Het
Prkaa2 T C 4: 105,051,247 N144D probably damaging Het
Ptprf C T 4: 118,257,608 R150H probably damaging Het
Sfmbt1 T G 14: 30,787,492 D309E probably damaging Het
Skint5 G T 4: 113,885,814 T352K unknown Het
Slc16a10 G C 10: 40,056,624 H314D possibly damaging Het
Slc28a2 C A 2: 122,454,515 A328E probably benign Het
Ssc4d C A 5: 135,970,316 W11L possibly damaging Het
Sycp2 C A 2: 178,380,927 M470I possibly damaging Het
Tfap2c A T 2: 172,556,190 S413C probably damaging Het
Unc13c A G 9: 73,533,906 probably null Het
Vmn1r218 T C 13: 23,136,801 V26A possibly damaging Het
Wipf3 G A 6: 54,481,828 G56D probably damaging Het
Wiz T C 17: 32,359,224 E429G probably damaging Het
Zer1 T C 2: 30,107,523 N457S probably damaging Het
Zfp931 T A 2: 178,067,984 Q203L possibly damaging Het
Other mutations in Elp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01800:Elp2 APN 18 24617491 missense probably benign 0.01
IGL01909:Elp2 APN 18 24619519 splice site probably benign
IGL01974:Elp2 APN 18 24626203 missense probably damaging 0.99
IGL02243:Elp2 APN 18 24622606 missense probably benign 0.11
IGL03049:Elp2 APN 18 24631459 missense probably benign 0.05
IGL03236:Elp2 APN 18 24622243 splice site probably benign
IGL03380:Elp2 APN 18 24622480 missense probably benign 0.05
Camelid UTSW 18 24625549 missense probably damaging 1.00
PIT4283001:Elp2 UTSW 18 24622130 missense probably damaging 1.00
PIT4531001:Elp2 UTSW 18 24604113 missense probably damaging 0.99
R0119:Elp2 UTSW 18 24634409 missense probably benign 0.03
R0244:Elp2 UTSW 18 24631471 missense possibly damaging 0.81
R0299:Elp2 UTSW 18 24634409 missense probably benign 0.03
R0609:Elp2 UTSW 18 24626156 missense probably benign
R0671:Elp2 UTSW 18 24612442 splice site probably benign
R1531:Elp2 UTSW 18 24631404 missense probably benign 0.06
R1658:Elp2 UTSW 18 24617413 missense probably benign 0.27
R1673:Elp2 UTSW 18 24611926 missense possibly damaging 0.93
R2012:Elp2 UTSW 18 24631458 missense probably benign 0.00
R3861:Elp2 UTSW 18 24606920 missense probably benign 0.01
R4396:Elp2 UTSW 18 24609650 missense probably damaging 1.00
R4507:Elp2 UTSW 18 24626120 splice site probably null
R4901:Elp2 UTSW 18 24619485 missense probably damaging 1.00
R5389:Elp2 UTSW 18 24606903 missense possibly damaging 0.87
R5511:Elp2 UTSW 18 24612450 nonsense probably null
R5633:Elp2 UTSW 18 24615210 missense probably damaging 1.00
R5728:Elp2 UTSW 18 24617452 missense probably damaging 1.00
R6585:Elp2 UTSW 18 24625549 missense probably damaging 1.00
R6855:Elp2 UTSW 18 24606877 missense possibly damaging 0.48
R6877:Elp2 UTSW 18 24634976 missense probably benign 0.00
R7145:Elp2 UTSW 18 24604069 missense probably benign 0.42
R7163:Elp2 UTSW 18 24614446 missense probably benign 0.00
R7313:Elp2 UTSW 18 24609659 missense probably benign 0.05
R7318:Elp2 UTSW 18 24606899 missense probably damaging 1.00
R7403:Elp2 UTSW 18 24619485 missense probably damaging 1.00
R7497:Elp2 UTSW 18 24611928 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- GCAGCAACTGTAGGCAAGAC -3'
(R):5'- AGTGAGATGCTACTGAACAACC -3'

Sequencing Primer
(F):5'- CGGGATTTCACTGCATTGGAACC -3'
(R):5'- GATGCTACTGAACAACCAACCAGG -3'
Posted On2015-04-30