Incidental Mutation 'R4038:Hnrnpul2'
ID313818
Institutional Source Beutler Lab
Gene Symbol Hnrnpul2
Ensembl Gene ENSMUSG00000071659
Gene Nameheterogeneous nuclear ribonucleoprotein U-like 2
Synonyms1110031M08Rik, Hnrpul2
MMRRC Submission 040965-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.745) question?
Stock #R4038 (G1)
Quality Score225
Status Validated
Chromosome19
Chromosomal Location8819401-8834142 bp(+) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) T to A at 8823227 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000120656 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000088092] [ENSMUST00000096751] [ENSMUST00000096753] [ENSMUST00000153281]
Predicted Effect probably benign
Transcript: ENSMUST00000088092
SMART Domains Protein: ENSMUSP00000085413
Gene: ENSMUSG00000071660

DomainStartEndE-ValueType
TPR 8 41 1.11e1 SMART
TPR 72 107 3.41e1 SMART
TPR 108 141 7.34e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000096751
SMART Domains Protein: ENSMUSP00000094513
Gene: ENSMUSG00000071660

DomainStartEndE-ValueType
TPR 8 41 1.11e1 SMART
TPR 72 107 3.41e1 SMART
TPR 108 141 7.34e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000096753
SMART Domains Protein: ENSMUSP00000094515
Gene: ENSMUSG00000071659

DomainStartEndE-ValueType
SAP 3 37 6.03e-9 SMART
low complexity region 68 126 N/A INTRINSIC
low complexity region 224 240 N/A INTRINSIC
SPRY 287 416 5.23e-32 SMART
Pfam:AAA_33 452 597 1.2e-25 PFAM
low complexity region 637 666 N/A INTRINSIC
low complexity region 700 719 N/A INTRINSIC
low complexity region 728 745 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148090
Predicted Effect probably benign
Transcript: ENSMUST00000153281
SMART Domains Protein: ENSMUSP00000120656
Gene: ENSMUSG00000071660

DomainStartEndE-ValueType
Pfam:TPR_11 6 93 1e-8 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 93.1%
Validation Efficiency 93% (39/42)
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ate1 A G 7: 130,504,765 S282P probably damaging Het
Cacna1d T A 14: 30,066,083 Q1610L probably damaging Het
Carmil2 C A 8: 105,695,407 R1103S probably damaging Het
Clca3a1 T A 3: 144,755,233 Y219F probably benign Het
Creb3l3 A G 10: 81,089,338 V224A probably benign Het
Crnkl1 T A 2: 145,932,327 D72V possibly damaging Het
Dhcr24 T C 4: 106,573,878 F255L probably benign Het
Eef2kmt A T 16: 5,245,271 V335D probably damaging Het
Elp2 T A 18: 24,634,348 W696R probably damaging Het
Glb1l3 A C 9: 26,829,047 M329R probably damaging Het
Gm4787 A T 12: 81,378,358 F342Y probably damaging Het
Gpr137c C A 14: 45,220,230 L80I probably damaging Het
Gpr83 A G 9: 14,860,777 I82V possibly damaging Het
Greb1l C T 18: 10,515,209 T558I possibly damaging Het
Hspa2 T C 12: 76,405,768 V412A probably damaging Het
Iqcd T C 5: 120,602,522 V306A probably damaging Het
Lmod3 T C 6: 97,248,314 N182S probably benign Het
Metrn T C 17: 25,795,010 T281A probably benign Het
Mid1-ps1 G A Y: 90,762,294 noncoding transcript Het
Mmachc T A 4: 116,706,018 T47S probably damaging Het
Nfia C A 4: 98,020,837 R277S probably damaging Het
Olfr1158 T A 2: 87,990,918 I269N possibly damaging Het
Pcdha8 T C 18: 36,992,861 M132T probably benign Het
Prkaa2 T C 4: 105,051,247 N144D probably damaging Het
Ptprf C T 4: 118,257,608 R150H probably damaging Het
Sfmbt1 T G 14: 30,787,492 D309E probably damaging Het
Skint5 G T 4: 113,885,814 T352K unknown Het
Slc16a10 G C 10: 40,056,624 H314D possibly damaging Het
Slc28a2 C A 2: 122,454,515 A328E probably benign Het
Ssc4d C A 5: 135,970,316 W11L possibly damaging Het
Sycp2 C A 2: 178,380,927 M470I possibly damaging Het
Tfap2c A T 2: 172,556,190 S413C probably damaging Het
Unc13c A G 9: 73,533,906 probably null Het
Vmn1r218 T C 13: 23,136,801 V26A possibly damaging Het
Wipf3 G A 6: 54,481,828 G56D probably damaging Het
Wiz T C 17: 32,359,224 E429G probably damaging Het
Zer1 T C 2: 30,107,523 N457S probably damaging Het
Zfp931 T A 2: 178,067,984 Q203L possibly damaging Het
Other mutations in Hnrnpul2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01989:Hnrnpul2 APN 19 8823628 missense probably damaging 1.00
R0136:Hnrnpul2 UTSW 19 8826801 missense probably damaging 1.00
R0369:Hnrnpul2 UTSW 19 8824413 missense probably damaging 1.00
R0781:Hnrnpul2 UTSW 19 8826746 missense probably damaging 1.00
R0784:Hnrnpul2 UTSW 19 8825052 missense possibly damaging 0.82
R1110:Hnrnpul2 UTSW 19 8826746 missense probably damaging 1.00
R1227:Hnrnpul2 UTSW 19 8823237 missense possibly damaging 0.91
R1589:Hnrnpul2 UTSW 19 8831332 missense probably benign 0.00
R2126:Hnrnpul2 UTSW 19 8824438 nonsense probably null
R2226:Hnrnpul2 UTSW 19 8824985 missense probably damaging 0.96
R2243:Hnrnpul2 UTSW 19 8820637 missense probably benign
R3703:Hnrnpul2 UTSW 19 8824409 missense probably damaging 1.00
R4856:Hnrnpul2 UTSW 19 8829827 missense probably benign 0.20
R4886:Hnrnpul2 UTSW 19 8829827 missense probably benign 0.20
R5016:Hnrnpul2 UTSW 19 8822825 missense possibly damaging 0.94
R5365:Hnrnpul2 UTSW 19 8820716 missense probably benign
R5435:Hnrnpul2 UTSW 19 8820318 missense probably benign 0.32
R5951:Hnrnpul2 UTSW 19 8824891 missense probably damaging 1.00
R6181:Hnrnpul2 UTSW 19 8823232 missense possibly damaging 0.70
R6824:Hnrnpul2 UTSW 19 8826717 missense possibly damaging 0.89
R6924:Hnrnpul2 UTSW 19 8831509 missense unknown
R6978:Hnrnpul2 UTSW 19 8824276 missense probably damaging 1.00
R7602:Hnrnpul2 UTSW 19 8831309 missense probably damaging 0.99
R7688:Hnrnpul2 UTSW 19 8820630 missense probably benign
R7726:Hnrnpul2 UTSW 19 8831280 missense possibly damaging 0.61
R7749:Hnrnpul2 UTSW 19 8820424 missense probably benign
R7753:Hnrnpul2 UTSW 19 8824972 missense probably damaging 1.00
R8007:Hnrnpul2 UTSW 19 8820815 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- TGGATTGAAAACTGGACTAGGTC -3'
(R):5'- ACACCAAGAAGTGCTGAGCC -3'

Sequencing Primer
(F):5'- GGTCCTTATAGGCATAAGTTTTAGAG -3'
(R):5'- GTCACTTTTAGATAGTCCAGAGGC -3'
Posted On2015-04-30