Mutagenetix > Incidental Mutation

Incidental Mutation 'R4039:Rims1'

313819

Institutional Source

Beutler Lab

Gene Symbol

Rims1

Ensembl Gene

ENSMUSG00000041670

Gene Name

regulating synaptic membrane exocytosis 1

Synonyms

RIM1a, RIM1, RIM1alpha, C030033M19Rik

MMRRC Submission

041614-MU

Accession Numbers

Essential gene?

Possibly essential (E-score: 0.581) question?

Stock #

R4039 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

22286251-22805994 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 22475712 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Glycine at position 537 (S537G)

Ref Sequence

ENSEMBL: ENSMUSP00000095419 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000081544] [ENSMUST00000097808] [ENSMUST00000097809] [ENSMUST00000097810] [ENSMUST00000097811] [ENSMUST00000115273]

AlphaFold

no structure available at present

Predicted Effect

possibly damaging
Transcript: ENSMUST00000081544
AA Change: S537G

PolyPhen 2 Score 0.824 (Sensitivity: 0.84; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000080259
Gene: ENSMUSG00000041670
AA Change: S537G

Domain	Start	End	E-Value	Type
low complexity region	5	18	N/A	INTRINSIC
coiled coil region	30	52	N/A	INTRINSIC
Pfam:FYVE_2	102	205	2.6e-9	PFAM
low complexity region	283	293	N/A	INTRINSIC
low complexity region	329	345	N/A	INTRINSIC
low complexity region	381	394	N/A	INTRINSIC
PDZ	449	528	1.44e-15	SMART
low complexity region	535	551	N/A	INTRINSIC
C2	593	703	7.55e-1	SMART
low complexity region	710	721	N/A	INTRINSIC
low complexity region	899	934	N/A	INTRINSIC
low complexity region	1011	1025	N/A	INTRINSIC
C2	1120	1223	7.45e-15	SMART
low complexity region	1245	1253	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000097808
AA Change: S715G

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)

SMART Domains

Protein: ENSMUSP00000095417
Gene: ENSMUSG00000041670
AA Change: S715G

Domain	Start	End	E-Value	Type
low complexity region	5	18	N/A	INTRINSIC
coiled coil region	30	52	N/A	INTRINSIC
Pfam:FYVE_2	102	205	3.3e-10	PFAM
low complexity region	283	293	N/A	INTRINSIC
low complexity region	329	345	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000097809
AA Change: S537G

PolyPhen 2 Score 0.824 (Sensitivity: 0.84; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000095418
Gene: ENSMUSG00000041670
AA Change: S537G

Domain	Start	End	E-Value	Type
low complexity region	5	18	N/A	INTRINSIC
coiled coil region	30	52	N/A	INTRINSIC
Pfam:FYVE_2	102	205	1e-9	PFAM
low complexity region	283	293	N/A	INTRINSIC
low complexity region	329	345	N/A	INTRINSIC
low complexity region	381	394	N/A	INTRINSIC
PDZ	449	528	1.44e-15	SMART
low complexity region	535	551	N/A	INTRINSIC
C2	593	703	7.55e-1	SMART
low complexity region	710	721	N/A	INTRINSIC
low complexity region	862	874	N/A	INTRINSIC
low complexity region	974	1009	N/A	INTRINSIC
low complexity region	1086	1100	N/A	INTRINSIC
C2	1195	1298	7.45e-15	SMART
low complexity region	1320	1328	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000097810
AA Change: S537G

PolyPhen 2 Score 0.960 (Sensitivity: 0.78; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000095419
Gene: ENSMUSG00000041670
AA Change: S537G

Domain	Start	End	E-Value	Type
low complexity region	5	18	N/A	INTRINSIC
coiled coil region	30	52	N/A	INTRINSIC
PDB:2CJS\|C	131	193	2e-32	PDB
low complexity region	283	293	N/A	INTRINSIC
low complexity region	329	345	N/A	INTRINSIC
low complexity region	381	394	N/A	INTRINSIC
PDZ	449	528	1.44e-15	SMART
low complexity region	535	551	N/A	INTRINSIC
C2	593	703	7.55e-1	SMART
low complexity region	710	721	N/A	INTRINSIC
low complexity region	862	874	N/A	INTRINSIC
low complexity region	916	929	N/A	INTRINSIC
low complexity region	1035	1070	N/A	INTRINSIC
low complexity region	1147	1161	N/A	INTRINSIC
C2	1256	1359	7.45e-15	SMART
low complexity region	1381	1389	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000097811
AA Change: S537G

PolyPhen 2 Score 0.035 (Sensitivity: 0.94; Specificity: 0.82)

SMART Domains

Protein: ENSMUSP00000095420
Gene: ENSMUSG00000041670
AA Change: S537G

Domain	Start	End	E-Value	Type
low complexity region	5	18	N/A	INTRINSIC
coiled coil region	30	52	N/A	INTRINSIC
Pfam:FYVE_2	102	205	1.6e-9	PFAM
low complexity region	283	293	N/A	INTRINSIC
low complexity region	329	345	N/A	INTRINSIC
low complexity region	381	394	N/A	INTRINSIC
PDZ	449	528	1.44e-15	SMART
low complexity region	535	551	N/A	INTRINSIC
C2	593	703	7.55e-1	SMART
low complexity region	710	721	N/A	INTRINSIC
low complexity region	867	881	N/A	INTRINSIC
low complexity region	944	957	N/A	INTRINSIC
low complexity region	1063	1098	N/A	INTRINSIC
low complexity region	1175	1189	N/A	INTRINSIC
C2	1284	1387	7.45e-15	SMART
low complexity region	1409	1417	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000115273
AA Change: S537G

PolyPhen 2 Score 0.920 (Sensitivity: 0.81; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000110928
Gene: ENSMUSG00000041670
AA Change: S537G

Domain	Start	End	E-Value	Type
low complexity region	5	18	N/A	INTRINSIC
coiled coil region	30	52	N/A	INTRINSIC
Pfam:FYVE_2	102	205	2.8e-9	PFAM
low complexity region	283	293	N/A	INTRINSIC
low complexity region	329	345	N/A	INTRINSIC
low complexity region	381	394	N/A	INTRINSIC
PDZ	449	528	1.44e-15	SMART
low complexity region	535	551	N/A	INTRINSIC
C2	593	703	7.55e-1	SMART
low complexity region	710	721	N/A	INTRINSIC
low complexity region	950	985	N/A	INTRINSIC
low complexity region	1062	1076	N/A	INTRINSIC
C2	1171	1274	7.45e-15	SMART
low complexity region	1296	1304	N/A	INTRINSIC

Meta Mutation Damage Score

0.0758

Coding Region Coverage

1x: 99.1%
3x: 98.5%
10x: 97.0%
20x: 94.0%

Validation Efficiency

98% (48/49)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a RAS gene superfamily member that regulates synaptic vesicle exocytosis. This gene also plays a role in the regulation of voltage-gated calcium channels during neurotransmitter and insulin release. Mutations have suggested a role cognition and have been identified as the cause of cone-rod dystrophy type 7. Multiple transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, Mar 2012]
PHENOTYPE: Mice homozygous for disruptions in this gene display defects in maternal care and abnormalities in synaptic transmission in the central nervous system. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 44 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4933412E24Rik	A	T	15: 60,016,366	L75Q	possibly damaging	Het
Cep290	T	C	10: 100,512,401		probably null	Het
Col11a2	A	G	17: 34,045,774	T268A	probably benign	Het
Crnkl1	T	A	2: 145,932,327	D72V	possibly damaging	Het
Csn2	C	T	5: 87,698,076	M1I	probably null	Het
Dhcr24	T	C	4: 106,573,878	F255L	probably benign	Het
Epn2	A	G	11: 61,546,522	Y75H	probably damaging	Het
Galnt3	A	T	2: 66,085,327	H563Q	probably damaging	Het
Galnt9	T	C	5: 110,614,208	V37A	probably damaging	Het
Glb1l3	A	C	9: 26,829,047	M329R	probably damaging	Het
Gorab	A	T	1: 163,397,066	D55E	possibly damaging	Het
Herc2	G	A	7: 56,156,411	R2318Q	probably damaging	Het
Hspa2	T	C	12: 76,405,768	V412A	probably damaging	Het
Hspb8	A	G	5: 116,409,344	V193A	probably benign	Het
Ly75	A	G	2: 60,352,995	L481P	probably damaging	Het
Lyzl1	T	C	18: 4,169,140	L48P	probably damaging	Het
Mettl27	C	T	5: 134,940,609	Q212*	probably null	Het
Mmachc	T	A	4: 116,706,018	T47S	probably damaging	Het
Ncam2	C	T	16: 81,490,323	S375L	probably benign	Het
Ogfrl1	T	C	1: 23,378,964		probably benign	Het
Parp9	T	C	16: 35,960,047	L461P	probably damaging	Het
Pcsk7	A	G	9: 45,928,007		probably null	Het
Plekhh1	C	A	12: 79,055,183	H342Q	probably benign	Het
Prdm13	T	G	4: 21,685,774		probably benign	Het
Prkaa2	T	C	4: 105,051,247	N144D	probably damaging	Het
Ptpn12	A	T	5: 21,002,510	Y283*	probably null	Het
Rab12	T	C	17: 66,500,401	Y111C	possibly damaging	Het
Ralgapa1	T	C	12: 55,795,701	N61S	probably damaging	Het
Sash1	G	T	10: 8,729,627	P1000T	probably damaging	Het
Skint5	G	T	4: 113,885,814	T352K	unknown	Het
Slc12a5	A	G	2: 164,992,330	E757G	probably benign	Het
Sycp2	C	A	2: 178,380,927	M470I	possibly damaging	Het
Szt2	T	C	4: 118,364,952		probably benign	Het
Tbc1d1	A	G	5: 64,316,428	T765A	probably damaging	Het
Tgfbr2	T	C	9: 116,175,037	M1V	probably null	Het
Tnfrsf11a	A	G	1: 105,827,739		probably null	Het
Trim43b	A	G	9: 89,091,347	L111P	probably damaging	Het
Ttbk2	A	T	2: 120,745,795	S900R	probably benign	Het
Unc79	G	A	12: 103,074,949	C747Y	possibly damaging	Het
Vmn1r218	T	C	13: 23,136,801	V26A	possibly damaging	Het
Vmn2r115	A	T	17: 23,345,103	Y83F	probably benign	Het
Zfp536	A	T	7: 37,569,550	L147Q	probably damaging	Het
Zfp931	T	A	2: 178,067,984	Q203L	possibly damaging	Het
Zswim2	G	A	2: 83,915,994	H367Y	probably damaging	Het

Other mutations in Rims1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00227:Rims1	APN	1	22468242	missense	probably damaging	1.00
IGL00535:Rims1	APN	1	22432921	missense	probably benign	0.02
IGL01021:Rims1	APN	1	22486620	missense	probably damaging	1.00
IGL01106:Rims1	APN	1	22379447	missense	probably damaging	1.00
IGL01128:Rims1	APN	1	22534175	missense	probably damaging	0.97
IGL01548:Rims1	APN	1	22538602	missense	probably damaging	1.00
IGL01688:Rims1	APN	1	22397540	missense	probably benign	0.22
IGL02089:Rims1	APN	1	22630475	missense	possibly damaging	0.68
IGL02245:Rims1	APN	1	22346488	missense	probably damaging	0.98
IGL02355:Rims1	APN	1	22483207	missense	probably damaging	1.00
IGL02362:Rims1	APN	1	22483207	missense	probably damaging	1.00
IGL02682:Rims1	APN	1	22288484	missense	probably damaging	1.00
IGL03006:Rims1	APN	1	22296954	missense	probably damaging	0.99
IGL03054:Rims1	UTSW	1	22290109	missense	probably damaging	1.00
PIT4504001:Rims1	UTSW	1	22397460	missense
R0031:Rims1	UTSW	1	22296879	missense	probably damaging	1.00
R0118:Rims1	UTSW	1	22346407	missense	probably damaging	1.00
R0390:Rims1	UTSW	1	22596526	missense	possibly damaging	0.92
R0483:Rims1	UTSW	1	22468182	splice site	probably benign
R0744:Rims1	UTSW	1	22427459	splice site	probably null
R0836:Rims1	UTSW	1	22427459	splice site	probably null
R1218:Rims1	UTSW	1	22483175	missense	probably damaging	1.00
R1228:Rims1	UTSW	1	22472756	missense	probably null	1.00
R1374:Rims1	UTSW	1	22296948	missense	probably damaging	1.00
R1474:Rims1	UTSW	1	22538281	splice site	probably benign
R1652:Rims1	UTSW	1	22292866	missense	probably damaging	1.00
R1712:Rims1	UTSW	1	22296948	missense	probably damaging	1.00
R1730:Rims1	UTSW	1	22346529	critical splice acceptor site	probably null
R1783:Rims1	UTSW	1	22346529	critical splice acceptor site	probably null
R1861:Rims1	UTSW	1	22596558	missense	probably damaging	1.00
R1899:Rims1	UTSW	1	22428474	missense	probably damaging	1.00
R1937:Rims1	UTSW	1	22288530	missense	probably damaging	1.00
R2010:Rims1	UTSW	1	22296996	missense	probably damaging	1.00
R2049:Rims1	UTSW	1	22596435	missense	probably damaging	1.00
R2124:Rims1	UTSW	1	22404508	nonsense	probably null
R2860:Rims1	UTSW	1	22432976	missense	probably benign	0.01
R2861:Rims1	UTSW	1	22432976	missense	probably benign	0.01
R2914:Rims1	UTSW	1	22805630	missense	probably damaging	1.00
R3740:Rims1	UTSW	1	22373443	missense	probably damaging	1.00
R3741:Rims1	UTSW	1	22373443	missense	probably damaging	1.00
R3773:Rims1	UTSW	1	22421810	missense	probably damaging	1.00
R3874:Rims1	UTSW	1	22428489	missense	probably damaging	1.00
R3901:Rims1	UTSW	1	22533497	missense	probably benign	0.00
R3964:Rims1	UTSW	1	22427459	splice site	probably null
R4037:Rims1	UTSW	1	22475712	missense	probably damaging	0.96
R4056:Rims1	UTSW	1	22292939	splice site	probably benign
R4062:Rims1	UTSW	1	22533583	missense	probably benign	0.00
R4552:Rims1	UTSW	1	22373494	missense	probably damaging	0.99
R4658:Rims1	UTSW	1	22427543	missense	probably damaging	0.98
R4688:Rims1	UTSW	1	22479447	nonsense	probably null
R4696:Rims1	UTSW	1	22288612	missense	probably damaging	1.00
R4720:Rims1	UTSW	1	22427481	missense	probably damaging	1.00
R4764:Rims1	UTSW	1	22479462	missense	probably damaging	1.00
R4780:Rims1	UTSW	1	22291105	missense	probably damaging	1.00
R4931:Rims1	UTSW	1	22533947	missense	probably benign	0.26
R5137:Rims1	UTSW	1	22288620	nonsense	probably null
R5153:Rims1	UTSW	1	22483247	nonsense	probably null
R5305:Rims1	UTSW	1	22596542	missense	probably damaging	0.99
R5354:Rims1	UTSW	1	22538511	missense	probably damaging	1.00
R5386:Rims1	UTSW	1	22412245	missense	probably damaging	0.99
R5485:Rims1	UTSW	1	22483208	missense	possibly damaging	0.93
R5643:Rims1	UTSW	1	22538509	missense	probably damaging	1.00
R5929:Rims1	UTSW	1	22468241	missense	probably damaging	1.00
R5988:Rims1	UTSW	1	22596463	missense	probably damaging	1.00
R6160:Rims1	UTSW	1	22432984	missense	probably damaging	0.98
R6579:Rims1	UTSW	1	22425916	missense	probably damaging	1.00
R6790:Rims1	UTSW	1	22468197	missense	probably damaging	1.00
R7048:Rims1	UTSW	1	22472820	missense	probably damaging	1.00
R7100:Rims1	UTSW	1	22346473	missense	probably benign	0.27
R7155:Rims1	UTSW	1	22432923	missense	probably damaging	0.99
R7171:Rims1	UTSW	1	22428489	missense
R7448:Rims1	UTSW	1	22404475	missense
R7505:Rims1	UTSW	1	22533996	missense	possibly damaging	0.55
R7567:Rims1	UTSW	1	22468210	missense	probably damaging	0.99
R7639:Rims1	UTSW	1	22805669	missense	probably benign	0.02
R7955:Rims1	UTSW	1	22468241	missense	probably damaging	1.00
R8005:Rims1	UTSW	1	22412213	missense
R8071:Rims1	UTSW	1	22288536	nonsense	probably null
R8465:Rims1	UTSW	1	22428480	missense	possibly damaging	0.89
R8517:Rims1	UTSW	1	22483165	missense	probably damaging	1.00
R8703:Rims1	UTSW	1	22425887	missense
R8726:Rims1	UTSW	1	22594100	missense	possibly damaging	0.88
R9090:Rims1	UTSW	1	22428522	missense
R9179:Rims1	UTSW	1	22412266	missense	probably damaging	0.99
R9271:Rims1	UTSW	1	22428522	missense
R9291:Rims1	UTSW	1	22397522	missense
R9394:Rims1	UTSW	1	22472775	missense	probably damaging	1.00
R9578:Rims1	UTSW	1	22484742	missense	probably damaging	1.00
R9614:Rims1	UTSW	1	22421745	nonsense	probably null
R9726:Rims1	UTSW	1	22630412	missense	probably null	0.21
Z1088:Rims1	UTSW	1	22288586	missense	probably damaging	1.00
Z1176:Rims1	UTSW	1	22484671	nonsense	probably null
Z1177:Rims1	UTSW	1	22296939	missense	possibly damaging	0.93
Z1177:Rims1	UTSW	1	22468241	missense	probably damaging	1.00
Z1177:Rims1	UTSW	1	22472777	missense	probably benign	0.44
Z1177:Rims1	UTSW	1	22472804	missense	probably damaging	1.00
Z1186:Rims1	UTSW	1	22379482	missense

Predicted Primers

PCR Primer
(F):5'- TGGCCCCAAAAGAAACTGG -3'
(R):5'- GTTTCACACTCATGCACATTAGTAG -3'

Sequencing Primer
(F):5'- AGAACCGTGGAGTTATTATGGC -3'
(R):5'- ACACTCATGCACATTAGTAGTTTCC -3'

Posted On

2015-04-30