Incidental Mutation 'R4039:Rims1'
ID 313819
Institutional Source Beutler Lab
Gene Symbol Rims1
Ensembl Gene ENSMUSG00000041670
Gene Name regulating synaptic membrane exocytosis 1
Synonyms RIM1alpha, C030033M19Rik, RIM1, RIM1a
MMRRC Submission 041614-MU
Accession Numbers
Essential gene? Possibly essential (E-score: 0.675) question?
Stock # R4039 (G1)
Quality Score 225
Status Validated
Chromosome 1
Chromosomal Location 22356475-22845203 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 22514793 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Glycine at position 537 (S537G)
Ref Sequence ENSEMBL: ENSMUSP00000095419 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000081544] [ENSMUST00000097808] [ENSMUST00000097809] [ENSMUST00000097810] [ENSMUST00000097811] [ENSMUST00000115273]
AlphaFold no structure available at present
Predicted Effect possibly damaging
Transcript: ENSMUST00000081544
AA Change: S537G

PolyPhen 2 Score 0.824 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000080259
Gene: ENSMUSG00000041670
AA Change: S537G

DomainStartEndE-ValueType
low complexity region 5 18 N/A INTRINSIC
coiled coil region 30 52 N/A INTRINSIC
Pfam:FYVE_2 102 205 2.6e-9 PFAM
low complexity region 283 293 N/A INTRINSIC
low complexity region 329 345 N/A INTRINSIC
low complexity region 381 394 N/A INTRINSIC
PDZ 449 528 1.44e-15 SMART
low complexity region 535 551 N/A INTRINSIC
C2 593 703 7.55e-1 SMART
low complexity region 710 721 N/A INTRINSIC
low complexity region 899 934 N/A INTRINSIC
low complexity region 1011 1025 N/A INTRINSIC
C2 1120 1223 7.45e-15 SMART
low complexity region 1245 1253 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000097808
AA Change: S715G

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000095417
Gene: ENSMUSG00000041670
AA Change: S715G

DomainStartEndE-ValueType
low complexity region 5 18 N/A INTRINSIC
coiled coil region 30 52 N/A INTRINSIC
Pfam:FYVE_2 102 205 3.3e-10 PFAM
low complexity region 283 293 N/A INTRINSIC
low complexity region 329 345 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000097809
AA Change: S537G

PolyPhen 2 Score 0.824 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000095418
Gene: ENSMUSG00000041670
AA Change: S537G

DomainStartEndE-ValueType
low complexity region 5 18 N/A INTRINSIC
coiled coil region 30 52 N/A INTRINSIC
Pfam:FYVE_2 102 205 1e-9 PFAM
low complexity region 283 293 N/A INTRINSIC
low complexity region 329 345 N/A INTRINSIC
low complexity region 381 394 N/A INTRINSIC
PDZ 449 528 1.44e-15 SMART
low complexity region 535 551 N/A INTRINSIC
C2 593 703 7.55e-1 SMART
low complexity region 710 721 N/A INTRINSIC
low complexity region 862 874 N/A INTRINSIC
low complexity region 974 1009 N/A INTRINSIC
low complexity region 1086 1100 N/A INTRINSIC
C2 1195 1298 7.45e-15 SMART
low complexity region 1320 1328 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000097810
AA Change: S537G

PolyPhen 2 Score 0.960 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000095419
Gene: ENSMUSG00000041670
AA Change: S537G

DomainStartEndE-ValueType
low complexity region 5 18 N/A INTRINSIC
coiled coil region 30 52 N/A INTRINSIC
PDB:2CJS|C 131 193 2e-32 PDB
low complexity region 283 293 N/A INTRINSIC
low complexity region 329 345 N/A INTRINSIC
low complexity region 381 394 N/A INTRINSIC
PDZ 449 528 1.44e-15 SMART
low complexity region 535 551 N/A INTRINSIC
C2 593 703 7.55e-1 SMART
low complexity region 710 721 N/A INTRINSIC
low complexity region 862 874 N/A INTRINSIC
low complexity region 916 929 N/A INTRINSIC
low complexity region 1035 1070 N/A INTRINSIC
low complexity region 1147 1161 N/A INTRINSIC
C2 1256 1359 7.45e-15 SMART
low complexity region 1381 1389 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000097811
AA Change: S537G

PolyPhen 2 Score 0.035 (Sensitivity: 0.94; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000095420
Gene: ENSMUSG00000041670
AA Change: S537G

DomainStartEndE-ValueType
low complexity region 5 18 N/A INTRINSIC
coiled coil region 30 52 N/A INTRINSIC
Pfam:FYVE_2 102 205 1.6e-9 PFAM
low complexity region 283 293 N/A INTRINSIC
low complexity region 329 345 N/A INTRINSIC
low complexity region 381 394 N/A INTRINSIC
PDZ 449 528 1.44e-15 SMART
low complexity region 535 551 N/A INTRINSIC
C2 593 703 7.55e-1 SMART
low complexity region 710 721 N/A INTRINSIC
low complexity region 867 881 N/A INTRINSIC
low complexity region 944 957 N/A INTRINSIC
low complexity region 1063 1098 N/A INTRINSIC
low complexity region 1175 1189 N/A INTRINSIC
C2 1284 1387 7.45e-15 SMART
low complexity region 1409 1417 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000115273
AA Change: S537G

PolyPhen 2 Score 0.920 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000110928
Gene: ENSMUSG00000041670
AA Change: S537G

DomainStartEndE-ValueType
low complexity region 5 18 N/A INTRINSIC
coiled coil region 30 52 N/A INTRINSIC
Pfam:FYVE_2 102 205 2.8e-9 PFAM
low complexity region 283 293 N/A INTRINSIC
low complexity region 329 345 N/A INTRINSIC
low complexity region 381 394 N/A INTRINSIC
PDZ 449 528 1.44e-15 SMART
low complexity region 535 551 N/A INTRINSIC
C2 593 703 7.55e-1 SMART
low complexity region 710 721 N/A INTRINSIC
low complexity region 950 985 N/A INTRINSIC
low complexity region 1062 1076 N/A INTRINSIC
C2 1171 1274 7.45e-15 SMART
low complexity region 1296 1304 N/A INTRINSIC
Meta Mutation Damage Score 0.0758 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.0%
Validation Efficiency 98% (48/49)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a RAS gene superfamily member that regulates synaptic vesicle exocytosis. This gene also plays a role in the regulation of voltage-gated calcium channels during neurotransmitter and insulin release. Mutations have suggested a role cognition and have been identified as the cause of cone-rod dystrophy type 7. Multiple transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, Mar 2012]
PHENOTYPE: Mice homozygous for disruptions in this gene display defects in maternal care and abnormalities in synaptic transmission in the central nervous system. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933412E24Rik A T 15: 59,888,215 (GRCm39) L75Q possibly damaging Het
Cep290 T C 10: 100,348,263 (GRCm39) probably null Het
Col11a2 A G 17: 34,264,748 (GRCm39) T268A probably benign Het
Crnkl1 T A 2: 145,774,247 (GRCm39) D72V possibly damaging Het
Csn2 C T 5: 87,845,935 (GRCm39) M1I probably null Het
Dhcr24 T C 4: 106,431,075 (GRCm39) F255L probably benign Het
Epn2 A G 11: 61,437,348 (GRCm39) Y75H probably damaging Het
Galnt3 A T 2: 65,915,671 (GRCm39) H563Q probably damaging Het
Galnt9 T C 5: 110,762,074 (GRCm39) V37A probably damaging Het
Glb1l3 A C 9: 26,740,343 (GRCm39) M329R probably damaging Het
Gorab A T 1: 163,224,635 (GRCm39) D55E possibly damaging Het
Herc2 G A 7: 55,806,159 (GRCm39) R2318Q probably damaging Het
Hspa2 T C 12: 76,452,542 (GRCm39) V412A probably damaging Het
Hspb8 A G 5: 116,547,403 (GRCm39) V193A probably benign Het
Ly75 A G 2: 60,183,339 (GRCm39) L481P probably damaging Het
Lyzl1 T C 18: 4,169,140 (GRCm39) L48P probably damaging Het
Mettl27 C T 5: 134,969,463 (GRCm39) Q212* probably null Het
Mmachc T A 4: 116,563,215 (GRCm39) T47S probably damaging Het
Ncam2 C T 16: 81,287,211 (GRCm39) S375L probably benign Het
Ogfrl1 T C 1: 23,418,045 (GRCm39) probably benign Het
Parp9 T C 16: 35,780,417 (GRCm39) L461P probably damaging Het
Pcsk7 A G 9: 45,839,305 (GRCm39) probably null Het
Plekhh1 C A 12: 79,101,957 (GRCm39) H342Q probably benign Het
Prdm13 T G 4: 21,685,774 (GRCm39) probably benign Het
Prkaa2 T C 4: 104,908,444 (GRCm39) N144D probably damaging Het
Ptpn12 A T 5: 21,207,508 (GRCm39) Y283* probably null Het
Rab12 T C 17: 66,807,396 (GRCm39) Y111C possibly damaging Het
Ralgapa1 T C 12: 55,842,486 (GRCm39) N61S probably damaging Het
Sash1 G T 10: 8,605,391 (GRCm39) P1000T probably damaging Het
Skint5 G T 4: 113,743,011 (GRCm39) T352K unknown Het
Slc12a5 A G 2: 164,834,250 (GRCm39) E757G probably benign Het
Sycp2 C A 2: 178,022,720 (GRCm39) M470I possibly damaging Het
Szt2 T C 4: 118,222,149 (GRCm39) probably benign Het
Tbc1d1 A G 5: 64,473,771 (GRCm39) T765A probably damaging Het
Tgfbr2 T C 9: 116,004,105 (GRCm39) M1V probably null Het
Tnfrsf11a A G 1: 105,755,464 (GRCm39) probably null Het
Trim43b A G 9: 88,973,400 (GRCm39) L111P probably damaging Het
Ttbk2 A T 2: 120,576,276 (GRCm39) S900R probably benign Het
Unc79 G A 12: 103,041,208 (GRCm39) C747Y possibly damaging Het
Vmn1r218 T C 13: 23,320,971 (GRCm39) V26A possibly damaging Het
Vmn2r115 A T 17: 23,564,077 (GRCm39) Y83F probably benign Het
Zfp536 A T 7: 37,268,975 (GRCm39) L147Q probably damaging Het
Zfp931 T A 2: 177,709,777 (GRCm39) Q203L possibly damaging Het
Zswim2 G A 2: 83,746,338 (GRCm39) H367Y probably damaging Het
Other mutations in Rims1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00227:Rims1 APN 1 22,507,323 (GRCm39) missense probably damaging 1.00
IGL00535:Rims1 APN 1 22,503,172 (GRCm39) missense probably benign 0.02
IGL01021:Rims1 APN 1 22,525,701 (GRCm39) missense probably damaging 1.00
IGL01106:Rims1 APN 1 22,449,671 (GRCm39) missense probably damaging 1.00
IGL01128:Rims1 APN 1 22,573,256 (GRCm39) missense probably damaging 0.97
IGL01548:Rims1 APN 1 22,577,683 (GRCm39) missense probably damaging 1.00
IGL01688:Rims1 APN 1 22,467,764 (GRCm39) missense probably benign 0.22
IGL02089:Rims1 APN 1 22,669,556 (GRCm39) missense possibly damaging 0.68
IGL02245:Rims1 APN 1 22,416,712 (GRCm39) missense probably damaging 0.98
IGL02355:Rims1 APN 1 22,522,288 (GRCm39) missense probably damaging 1.00
IGL02362:Rims1 APN 1 22,522,288 (GRCm39) missense probably damaging 1.00
IGL02682:Rims1 APN 1 22,358,708 (GRCm39) missense probably damaging 1.00
IGL03006:Rims1 APN 1 22,367,178 (GRCm39) missense probably damaging 0.99
IGL03054:Rims1 UTSW 1 22,360,333 (GRCm39) missense probably damaging 1.00
PIT4504001:Rims1 UTSW 1 22,467,684 (GRCm39) missense
R0031:Rims1 UTSW 1 22,367,103 (GRCm39) missense probably damaging 1.00
R0118:Rims1 UTSW 1 22,416,631 (GRCm39) missense probably damaging 1.00
R0390:Rims1 UTSW 1 22,635,607 (GRCm39) missense possibly damaging 0.92
R0483:Rims1 UTSW 1 22,507,263 (GRCm39) splice site probably benign
R0744:Rims1 UTSW 1 22,497,709 (GRCm39) splice site probably null
R0836:Rims1 UTSW 1 22,497,709 (GRCm39) splice site probably null
R1218:Rims1 UTSW 1 22,522,256 (GRCm39) missense probably damaging 1.00
R1228:Rims1 UTSW 1 22,511,837 (GRCm39) missense probably null 1.00
R1374:Rims1 UTSW 1 22,367,172 (GRCm39) missense probably damaging 1.00
R1474:Rims1 UTSW 1 22,577,362 (GRCm39) splice site probably benign
R1652:Rims1 UTSW 1 22,363,090 (GRCm39) missense probably damaging 1.00
R1712:Rims1 UTSW 1 22,367,172 (GRCm39) missense probably damaging 1.00
R1730:Rims1 UTSW 1 22,416,753 (GRCm39) critical splice acceptor site probably null
R1783:Rims1 UTSW 1 22,416,753 (GRCm39) critical splice acceptor site probably null
R1861:Rims1 UTSW 1 22,635,639 (GRCm39) missense probably damaging 1.00
R1899:Rims1 UTSW 1 22,498,725 (GRCm39) missense probably damaging 1.00
R1937:Rims1 UTSW 1 22,358,754 (GRCm39) missense probably damaging 1.00
R2010:Rims1 UTSW 1 22,367,220 (GRCm39) missense probably damaging 1.00
R2049:Rims1 UTSW 1 22,635,516 (GRCm39) missense probably damaging 1.00
R2124:Rims1 UTSW 1 22,474,732 (GRCm39) nonsense probably null
R2860:Rims1 UTSW 1 22,503,227 (GRCm39) missense probably benign 0.01
R2861:Rims1 UTSW 1 22,503,227 (GRCm39) missense probably benign 0.01
R2914:Rims1 UTSW 1 22,844,711 (GRCm39) missense probably damaging 1.00
R3740:Rims1 UTSW 1 22,443,667 (GRCm39) missense probably damaging 1.00
R3741:Rims1 UTSW 1 22,443,667 (GRCm39) missense probably damaging 1.00
R3773:Rims1 UTSW 1 22,492,034 (GRCm39) missense probably damaging 1.00
R3874:Rims1 UTSW 1 22,498,740 (GRCm39) missense probably damaging 1.00
R3901:Rims1 UTSW 1 22,572,578 (GRCm39) missense probably benign 0.00
R3964:Rims1 UTSW 1 22,497,709 (GRCm39) splice site probably null
R4037:Rims1 UTSW 1 22,514,793 (GRCm39) missense probably damaging 0.96
R4056:Rims1 UTSW 1 22,363,163 (GRCm39) splice site probably benign
R4062:Rims1 UTSW 1 22,572,664 (GRCm39) missense probably benign 0.00
R4552:Rims1 UTSW 1 22,443,718 (GRCm39) missense probably damaging 0.99
R4658:Rims1 UTSW 1 22,497,793 (GRCm39) missense probably damaging 0.98
R4688:Rims1 UTSW 1 22,518,528 (GRCm39) nonsense probably null
R4696:Rims1 UTSW 1 22,358,836 (GRCm39) missense probably damaging 1.00
R4720:Rims1 UTSW 1 22,497,731 (GRCm39) missense probably damaging 1.00
R4764:Rims1 UTSW 1 22,518,543 (GRCm39) missense probably damaging 1.00
R4780:Rims1 UTSW 1 22,361,329 (GRCm39) missense probably damaging 1.00
R4931:Rims1 UTSW 1 22,573,028 (GRCm39) missense probably benign 0.26
R5137:Rims1 UTSW 1 22,358,844 (GRCm39) nonsense probably null
R5153:Rims1 UTSW 1 22,522,328 (GRCm39) nonsense probably null
R5305:Rims1 UTSW 1 22,635,623 (GRCm39) missense probably damaging 0.99
R5354:Rims1 UTSW 1 22,577,592 (GRCm39) missense probably damaging 1.00
R5386:Rims1 UTSW 1 22,482,469 (GRCm39) missense probably damaging 0.99
R5485:Rims1 UTSW 1 22,522,289 (GRCm39) missense possibly damaging 0.93
R5643:Rims1 UTSW 1 22,577,590 (GRCm39) missense probably damaging 1.00
R5929:Rims1 UTSW 1 22,507,322 (GRCm39) missense probably damaging 1.00
R5988:Rims1 UTSW 1 22,635,544 (GRCm39) missense probably damaging 1.00
R6160:Rims1 UTSW 1 22,503,235 (GRCm39) missense probably damaging 0.98
R6579:Rims1 UTSW 1 22,496,166 (GRCm39) missense probably damaging 1.00
R6790:Rims1 UTSW 1 22,507,278 (GRCm39) missense probably damaging 1.00
R7048:Rims1 UTSW 1 22,511,901 (GRCm39) missense probably damaging 1.00
R7100:Rims1 UTSW 1 22,416,697 (GRCm39) missense probably benign 0.27
R7155:Rims1 UTSW 1 22,503,174 (GRCm39) missense probably damaging 0.99
R7171:Rims1 UTSW 1 22,498,740 (GRCm39) missense
R7448:Rims1 UTSW 1 22,474,699 (GRCm39) missense
R7505:Rims1 UTSW 1 22,573,077 (GRCm39) missense possibly damaging 0.55
R7567:Rims1 UTSW 1 22,507,291 (GRCm39) missense probably damaging 0.99
R7639:Rims1 UTSW 1 22,844,750 (GRCm39) missense probably benign 0.02
R7955:Rims1 UTSW 1 22,507,322 (GRCm39) missense probably damaging 1.00
R8005:Rims1 UTSW 1 22,482,437 (GRCm39) missense
R8071:Rims1 UTSW 1 22,358,760 (GRCm39) nonsense probably null
R8465:Rims1 UTSW 1 22,498,731 (GRCm39) missense possibly damaging 0.89
R8517:Rims1 UTSW 1 22,522,246 (GRCm39) missense probably damaging 1.00
R8703:Rims1 UTSW 1 22,496,137 (GRCm39) missense
R8726:Rims1 UTSW 1 22,633,181 (GRCm39) missense possibly damaging 0.88
R9090:Rims1 UTSW 1 22,498,773 (GRCm39) missense
R9179:Rims1 UTSW 1 22,482,490 (GRCm39) missense probably damaging 0.99
R9271:Rims1 UTSW 1 22,498,773 (GRCm39) missense
R9291:Rims1 UTSW 1 22,467,746 (GRCm39) missense
R9394:Rims1 UTSW 1 22,511,856 (GRCm39) missense probably damaging 1.00
R9578:Rims1 UTSW 1 22,523,823 (GRCm39) missense probably damaging 1.00
R9614:Rims1 UTSW 1 22,491,969 (GRCm39) nonsense probably null
R9726:Rims1 UTSW 1 22,669,493 (GRCm39) missense probably null 0.21
Z1088:Rims1 UTSW 1 22,358,810 (GRCm39) missense probably damaging 1.00
Z1176:Rims1 UTSW 1 22,523,752 (GRCm39) nonsense probably null
Z1177:Rims1 UTSW 1 22,511,858 (GRCm39) missense probably benign 0.44
Z1177:Rims1 UTSW 1 22,507,322 (GRCm39) missense probably damaging 1.00
Z1177:Rims1 UTSW 1 22,367,163 (GRCm39) missense possibly damaging 0.93
Z1177:Rims1 UTSW 1 22,511,885 (GRCm39) missense probably damaging 1.00
Z1186:Rims1 UTSW 1 22,449,706 (GRCm39) missense
Predicted Primers PCR Primer
(F):5'- TGGCCCCAAAAGAAACTGG -3'
(R):5'- GTTTCACACTCATGCACATTAGTAG -3'

Sequencing Primer
(F):5'- AGAACCGTGGAGTTATTATGGC -3'
(R):5'- ACACTCATGCACATTAGTAGTTTCC -3'
Posted On 2015-04-30