Incidental Mutation 'R4039:Sash1'
ID313852
Institutional Source Beutler Lab
Gene Symbol Sash1
Ensembl Gene ENSMUSG00000015305
Gene NameSAM and SH3 domain containing 1
Synonyms
MMRRC Submission 041614-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4039 (G1)
Quality Score212
Status Validated
Chromosome10
Chromosomal Location8722219-8886070 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 8729627 bp
ZygosityHeterozygous
Amino Acid Change Proline to Threonine at position 1000 (P1000T)
Ref Sequence ENSEMBL: ENSMUSP00000015449 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000015449]
Predicted Effect probably damaging
Transcript: ENSMUST00000015449
AA Change: P1000T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000015449
Gene: ENSMUSG00000015305
AA Change: P1000T

DomainStartEndE-ValueType
low complexity region 2 21 N/A INTRINSIC
coiled coil region 185 212 N/A INTRINSIC
low complexity region 323 336 N/A INTRINSIC
Pfam:SLY 394 548 1.2e-46 PFAM
SH3 550 607 1.16e-3 SMART
SAM 623 690 1.83e-11 SMART
low complexity region 1008 1021 N/A INTRINSIC
SAM 1157 1224 3.6e-10 SMART
Meta Mutation Damage Score 0.1199 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.0%
Validation Efficiency 98% (48/49)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a scaffold protein involved in the TLR4 signaling pathway that may stimulate cytokine production and endothelial cell migration in response to invading pathogens. The encoded protein has also been described as a potential tumor suppressor that may negatively regulate proliferation, apoptosis, and invasion of cancer cells, and reduced expression of this gene has been observed in multiple human cancers. Mutations in this gene may be associated with abnormal skin pigmentation in human patients. [provided by RefSeq, Oct 2016]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933412E24Rik A T 15: 60,016,366 L75Q possibly damaging Het
Cep290 T C 10: 100,512,401 probably null Het
Col11a2 A G 17: 34,045,774 T268A probably benign Het
Crnkl1 T A 2: 145,932,327 D72V possibly damaging Het
Csn2 C T 5: 87,698,076 M1I probably null Het
Dhcr24 T C 4: 106,573,878 F255L probably benign Het
Epn2 A G 11: 61,546,522 Y75H probably damaging Het
Galnt3 A T 2: 66,085,327 H563Q probably damaging Het
Galnt9 T C 5: 110,614,208 V37A probably damaging Het
Glb1l3 A C 9: 26,829,047 M329R probably damaging Het
Gorab A T 1: 163,397,066 D55E possibly damaging Het
Herc2 G A 7: 56,156,411 R2318Q probably damaging Het
Hspa2 T C 12: 76,405,768 V412A probably damaging Het
Hspb8 A G 5: 116,409,344 V193A probably benign Het
Ly75 A G 2: 60,352,995 L481P probably damaging Het
Lyzl1 T C 18: 4,169,140 L48P probably damaging Het
Mettl27 C T 5: 134,940,609 Q212* probably null Het
Mmachc T A 4: 116,706,018 T47S probably damaging Het
Ncam2 C T 16: 81,490,323 S375L probably benign Het
Ogfrl1 T C 1: 23,378,964 probably benign Het
Parp9 T C 16: 35,960,047 L461P probably damaging Het
Pcsk7 A G 9: 45,928,007 probably null Het
Plekhh1 C A 12: 79,055,183 H342Q probably benign Het
Prdm13 T G 4: 21,685,774 probably benign Het
Prkaa2 T C 4: 105,051,247 N144D probably damaging Het
Ptpn12 A T 5: 21,002,510 Y283* probably null Het
Rab12 T C 17: 66,500,401 Y111C possibly damaging Het
Ralgapa1 T C 12: 55,795,701 N61S probably damaging Het
Rims1 T C 1: 22,475,712 S537G probably damaging Het
Skint5 G T 4: 113,885,814 T352K unknown Het
Slc12a5 A G 2: 164,992,330 E757G probably benign Het
Sycp2 C A 2: 178,380,927 M470I possibly damaging Het
Szt2 T C 4: 118,364,952 probably benign Het
Tbc1d1 A G 5: 64,316,428 T765A probably damaging Het
Tgfbr2 T C 9: 116,175,037 M1V probably null Het
Tnfrsf11a A G 1: 105,827,739 probably null Het
Trim43b A G 9: 89,091,347 L111P probably damaging Het
Ttbk2 A T 2: 120,745,795 S900R probably benign Het
Unc79 G A 12: 103,074,949 C747Y possibly damaging Het
Vmn1r218 T C 13: 23,136,801 V26A possibly damaging Het
Vmn2r115 A T 17: 23,345,103 Y83F probably benign Het
Zfp536 A T 7: 37,569,550 L147Q probably damaging Het
Zfp931 T A 2: 178,067,984 Q203L possibly damaging Het
Zswim2 G A 2: 83,915,994 H367Y probably damaging Het
Other mutations in Sash1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00987:Sash1 APN 10 8751413 missense probably damaging 1.00
IGL01535:Sash1 APN 10 8741577 missense probably damaging 1.00
IGL01537:Sash1 APN 10 8729658 missense probably damaging 1.00
IGL01788:Sash1 APN 10 8733646 missense probably benign 0.01
IGL01933:Sash1 APN 10 8751133 missense probably damaging 0.99
IGL02126:Sash1 APN 10 8739465 missense probably damaging 0.96
IGL02285:Sash1 APN 10 8740334 missense probably damaging 0.99
IGL02400:Sash1 APN 10 8733647 nonsense probably null
IGL02504:Sash1 APN 10 8729912 missense probably benign 0.00
IGL02630:Sash1 APN 10 8744535 missense probably benign 0.06
R0592:Sash1 UTSW 10 8729782 missense probably benign 0.00
R0647:Sash1 UTSW 10 8729552 missense probably damaging 0.99
R0656:Sash1 UTSW 10 8751137 critical splice donor site probably null
R0830:Sash1 UTSW 10 8729909 missense probably benign 0.01
R0919:Sash1 UTSW 10 8730079 missense probably benign 0.01
R1470:Sash1 UTSW 10 8789593 missense probably damaging 1.00
R1470:Sash1 UTSW 10 8789593 missense probably damaging 1.00
R1606:Sash1 UTSW 10 8729957 missense probably benign 0.00
R1707:Sash1 UTSW 10 8730377 missense probably benign 0.00
R1922:Sash1 UTSW 10 8727908 missense possibly damaging 0.62
R1940:Sash1 UTSW 10 8729932 missense probably benign
R1964:Sash1 UTSW 10 8729713 missense probably benign 0.01
R2013:Sash1 UTSW 10 8729413 missense probably benign 0.03
R2014:Sash1 UTSW 10 8729413 missense probably benign 0.03
R2015:Sash1 UTSW 10 8729413 missense probably benign 0.03
R2074:Sash1 UTSW 10 8756697 missense probably damaging 1.00
R2252:Sash1 UTSW 10 8729977 missense probably benign 0.01
R2253:Sash1 UTSW 10 8729977 missense probably benign 0.01
R2260:Sash1 UTSW 10 8786378 nonsense probably null
R3085:Sash1 UTSW 10 8742422 splice site probably null
R4024:Sash1 UTSW 10 8729917 missense probably benign 0.00
R4290:Sash1 UTSW 10 8730242 missense possibly damaging 0.59
R4292:Sash1 UTSW 10 8730242 missense possibly damaging 0.59
R4295:Sash1 UTSW 10 8730242 missense possibly damaging 0.59
R4301:Sash1 UTSW 10 8751470 missense probably benign 0.00
R4657:Sash1 UTSW 10 8725660 missense probably damaging 1.00
R4669:Sash1 UTSW 10 8730385 missense probably benign 0.00
R4719:Sash1 UTSW 10 8729713 missense probably benign 0.01
R4745:Sash1 UTSW 10 8729908 missense probably benign
R5197:Sash1 UTSW 10 8740225 missense probably damaging 1.00
R5217:Sash1 UTSW 10 8780604 missense possibly damaging 0.63
R5420:Sash1 UTSW 10 8746186 missense probably damaging 1.00
R5591:Sash1 UTSW 10 8725718 missense probably benign 0.36
R6505:Sash1 UTSW 10 8729527 missense probably benign 0.21
R6679:Sash1 UTSW 10 8740185 missense probably damaging 1.00
R6761:Sash1 UTSW 10 8744522 missense probably damaging 0.99
R6885:Sash1 UTSW 10 8784221 missense probably damaging 1.00
R6980:Sash1 UTSW 10 8729848 missense probably benign 0.00
R7034:Sash1 UTSW 10 8730083 nonsense probably null
R7036:Sash1 UTSW 10 8730083 nonsense probably null
R7088:Sash1 UTSW 10 8729717 nonsense probably null
R7289:Sash1 UTSW 10 8730196 missense probably damaging 0.99
R7464:Sash1 UTSW 10 8756745 missense possibly damaging 0.82
R7661:Sash1 UTSW 10 8729391 missense probably benign 0.01
R7752:Sash1 UTSW 10 8780564 nonsense probably null
R7856:Sash1 UTSW 10 8729708 missense probably benign 0.00
R7901:Sash1 UTSW 10 8780564 nonsense probably null
R7939:Sash1 UTSW 10 8729708 missense probably benign 0.00
R7984:Sash1 UTSW 10 8780564 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GAAACCTTCCTGCTCAGCAC -3'
(R):5'- ACAAGGACGTCTCTTGAGGG -3'

Sequencing Primer
(F):5'- GGCCCAGTTTCACACCATG -3'
(R):5'- CGTCTCTTGAGGGTCTCAGAAAAG -3'
Posted On2015-04-30