Incidental Mutation 'R4041:Styxl2'
ID 313871
Institutional Source Beutler Lab
Gene Symbol Styxl2
Ensembl Gene ENSMUSG00000026564
Gene Name serine/threonine/tyrosine interacting like 2
Synonyms C130085G02Rik, Dusp27
MMRRC Submission 040966-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R4041 (G1)
Quality Score 225
Status Validated
Chromosome 1
Chromosomal Location 165925717-165955467 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 165927680 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 644 (D644G)
Ref Sequence ENSEMBL: ENSMUSP00000141564 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000085992] [ENSMUST00000192369]
AlphaFold Q148W8
Predicted Effect probably benign
Transcript: ENSMUST00000085992
AA Change: D644G

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000083155
Gene: ENSMUSG00000026564
AA Change: D644G

DomainStartEndE-ValueType
low complexity region 6 20 N/A INTRINSIC
DSPc 133 277 2.45e-30 SMART
low complexity region 339 348 N/A INTRINSIC
low complexity region 404 425 N/A INTRINSIC
low complexity region 429 439 N/A INTRINSIC
low complexity region 618 635 N/A INTRINSIC
low complexity region 655 666 N/A INTRINSIC
low complexity region 773 788 N/A INTRINSIC
coiled coil region 813 839 N/A INTRINSIC
low complexity region 851 860 N/A INTRINSIC
low complexity region 936 950 N/A INTRINSIC
low complexity region 1001 1019 N/A INTRINSIC
low complexity region 1026 1040 N/A INTRINSIC
low complexity region 1074 1091 N/A INTRINSIC
low complexity region 1108 1120 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000192369
AA Change: D644G

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000141564
Gene: ENSMUSG00000026564
AA Change: D644G

DomainStartEndE-ValueType
low complexity region 6 20 N/A INTRINSIC
DSPc 133 277 2.45e-30 SMART
low complexity region 339 348 N/A INTRINSIC
low complexity region 404 425 N/A INTRINSIC
low complexity region 429 439 N/A INTRINSIC
low complexity region 618 635 N/A INTRINSIC
low complexity region 655 666 N/A INTRINSIC
low complexity region 773 788 N/A INTRINSIC
coiled coil region 813 839 N/A INTRINSIC
low complexity region 851 860 N/A INTRINSIC
low complexity region 936 950 N/A INTRINSIC
low complexity region 1001 1019 N/A INTRINSIC
low complexity region 1026 1040 N/A INTRINSIC
low complexity region 1074 1091 N/A INTRINSIC
low complexity region 1108 1120 N/A INTRINSIC
Meta Mutation Damage Score 0.0720 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.4%
Validation Efficiency 100% (29/29)
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Atf5 T C 7: 44,462,921 (GRCm39) T68A possibly damaging Het
Cage1 A G 13: 38,203,153 (GRCm39) L637P possibly damaging Het
Cfl1 T C 19: 5,542,556 (GRCm39) I12T probably benign Het
Clcn1 A G 6: 42,286,902 (GRCm39) E653G probably damaging Het
Cntnap5a C A 1: 116,112,129 (GRCm39) P473Q probably benign Het
Dnah7b T C 1: 46,120,655 (GRCm39) S91P probably benign Het
Fcgbp A G 7: 27,813,404 (GRCm39) Q2313R probably benign Het
Gpc5 A T 14: 115,370,628 (GRCm39) Q151L probably damaging Het
Hexim1 A G 11: 103,007,932 (GRCm39) E62G probably benign Het
Ifna13 A G 4: 88,562,228 (GRCm39) F132S probably benign Het
Irgm2 A G 11: 58,110,956 (GRCm39) M228V probably benign Het
Klhl41 A G 2: 69,501,054 (GRCm39) M172V probably benign Het
Klk1 A T 7: 43,878,986 (GRCm39) N260I probably damaging Het
Krit1 G C 5: 3,859,642 (GRCm39) R110P probably damaging Het
Krt7 T A 15: 101,321,161 (GRCm39) probably null Het
Lrrn4cl T A 19: 8,829,468 (GRCm39) Y149N probably damaging Het
Ltbp3 G T 19: 5,801,899 (GRCm39) C739F possibly damaging Het
Mbnl2 C T 14: 120,626,486 (GRCm39) H239Y probably damaging Het
Obscn G A 11: 58,942,357 (GRCm39) R4942* probably null Het
Or2bd2 T C 7: 6,443,688 (GRCm39) L263P probably damaging Het
R3hcc1 A G 14: 69,944,111 (GRCm39) S45P probably damaging Het
Ryr1 A T 7: 28,785,356 (GRCm39) H1778Q possibly damaging Het
Scyl2 T A 10: 89,485,914 (GRCm39) K558N probably damaging Het
Shank1 G A 7: 43,991,586 (GRCm39) V677M unknown Het
Slc39a5 T C 10: 128,232,337 (GRCm39) M488V possibly damaging Het
Styk1 A T 6: 131,289,880 (GRCm39) probably null Het
Usp32 A G 11: 84,908,565 (GRCm39) V1047A probably benign Het
Wnt3a G T 11: 59,140,470 (GRCm39) H349N probably damaging Het
Zbtb39 T C 10: 127,579,423 (GRCm39) C666R probably damaging Het
Zfp420 T C 7: 29,575,427 (GRCm39) M549T probably benign Het
Other mutations in Styxl2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00706:Styxl2 APN 1 165,928,121 (GRCm39) missense probably benign 0.00
IGL00973:Styxl2 APN 1 165,927,027 (GRCm39) missense probably benign
IGL01331:Styxl2 APN 1 165,935,749 (GRCm39) missense probably damaging 1.00
IGL01466:Styxl2 APN 1 165,928,073 (GRCm39) missense probably damaging 1.00
IGL01572:Styxl2 APN 1 165,927,941 (GRCm39) missense probably benign 0.18
IGL01906:Styxl2 APN 1 165,927,092 (GRCm39) missense probably damaging 1.00
IGL01974:Styxl2 APN 1 165,928,105 (GRCm39) nonsense probably null
IGL02112:Styxl2 APN 1 165,927,240 (GRCm39) nonsense probably null
IGL02805:Styxl2 APN 1 165,926,630 (GRCm39) missense probably damaging 1.00
IGL03343:Styxl2 APN 1 165,927,017 (GRCm39) missense probably benign 0.00
R0116:Styxl2 UTSW 1 165,927,270 (GRCm39) missense probably benign 0.19
R0367:Styxl2 UTSW 1 165,928,332 (GRCm39) missense probably benign 0.05
R0499:Styxl2 UTSW 1 165,926,670 (GRCm39) missense probably benign 0.00
R0542:Styxl2 UTSW 1 165,928,853 (GRCm39) missense possibly damaging 0.90
R1312:Styxl2 UTSW 1 165,926,860 (GRCm39) missense possibly damaging 0.46
R1572:Styxl2 UTSW 1 165,927,024 (GRCm39) missense possibly damaging 0.68
R1598:Styxl2 UTSW 1 165,937,828 (GRCm39) missense probably benign 0.10
R1858:Styxl2 UTSW 1 165,928,415 (GRCm39) missense possibly damaging 0.87
R2021:Styxl2 UTSW 1 165,928,392 (GRCm39) missense probably benign 0.00
R2970:Styxl2 UTSW 1 165,926,798 (GRCm39) missense probably benign 0.04
R3727:Styxl2 UTSW 1 165,927,075 (GRCm39) missense probably damaging 1.00
R4245:Styxl2 UTSW 1 165,928,685 (GRCm39) missense probably damaging 1.00
R4955:Styxl2 UTSW 1 165,935,661 (GRCm39) missense probably damaging 1.00
R4967:Styxl2 UTSW 1 165,954,675 (GRCm39) missense probably damaging 1.00
R5040:Styxl2 UTSW 1 165,927,914 (GRCm39) missense probably benign 0.17
R5342:Styxl2 UTSW 1 165,937,819 (GRCm39) missense probably benign 0.01
R5467:Styxl2 UTSW 1 165,939,599 (GRCm39) critical splice donor site probably null
R5742:Styxl2 UTSW 1 165,927,023 (GRCm39) missense probably benign 0.00
R6222:Styxl2 UTSW 1 165,926,214 (GRCm39) missense probably benign 0.26
R6239:Styxl2 UTSW 1 165,926,388 (GRCm39) missense probably damaging 1.00
R6531:Styxl2 UTSW 1 165,937,615 (GRCm39) splice site probably null
R6586:Styxl2 UTSW 1 165,928,454 (GRCm39) missense possibly damaging 0.79
R6958:Styxl2 UTSW 1 165,935,565 (GRCm39) missense probably damaging 1.00
R7006:Styxl2 UTSW 1 165,926,663 (GRCm39) missense probably benign
R7111:Styxl2 UTSW 1 165,954,723 (GRCm39) missense possibly damaging 0.66
R7310:Styxl2 UTSW 1 165,926,300 (GRCm39) missense possibly damaging 0.46
R7312:Styxl2 UTSW 1 165,954,676 (GRCm39) missense probably damaging 0.99
R7378:Styxl2 UTSW 1 165,939,632 (GRCm39) nonsense probably null
R7398:Styxl2 UTSW 1 165,928,044 (GRCm39) missense probably damaging 1.00
R7442:Styxl2 UTSW 1 165,928,584 (GRCm39) missense probably benign 0.01
R7569:Styxl2 UTSW 1 165,935,604 (GRCm39) missense probably damaging 1.00
R7920:Styxl2 UTSW 1 165,927,465 (GRCm39) missense possibly damaging 0.72
R7954:Styxl2 UTSW 1 165,926,849 (GRCm39) missense probably benign 0.05
R7972:Styxl2 UTSW 1 165,926,708 (GRCm39) missense probably damaging 1.00
R8186:Styxl2 UTSW 1 165,927,648 (GRCm39) missense probably damaging 1.00
R8354:Styxl2 UTSW 1 165,935,702 (GRCm39) missense probably damaging 1.00
R8454:Styxl2 UTSW 1 165,935,702 (GRCm39) missense probably damaging 1.00
R8535:Styxl2 UTSW 1 165,928,730 (GRCm39) missense probably benign 0.01
R9419:Styxl2 UTSW 1 165,927,755 (GRCm39) missense probably damaging 1.00
R9493:Styxl2 UTSW 1 165,926,410 (GRCm39) missense probably damaging 1.00
R9694:Styxl2 UTSW 1 165,928,654 (GRCm39) missense probably damaging 1.00
Z1088:Styxl2 UTSW 1 165,926,852 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTGGCAATGGAAATGGTGTC -3'
(R):5'- AGAAGAACCTCTCTGATGTCAACC -3'

Sequencing Primer
(F):5'- TGGTGTCTCCAGGCCCC -3'
(R):5'- GTCAACCTGACAGCCTACCAG -3'
Posted On 2015-04-30