Incidental Mutation 'R4041:Gpc5'
ID313893
Institutional Source Beutler Lab
Gene Symbol Gpc5
Ensembl Gene ENSMUSG00000022112
Gene Nameglypican 5
SynonymsA230034F01Rik
MMRRC Submission 040966-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4041 (G1)
Quality Score225
Status Validated
Chromosome14
Chromosomal Location115092215-116525179 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 115133216 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Leucine at position 151 (Q151L)
Ref Sequence ENSEMBL: ENSMUSP00000135085 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022707] [ENSMUST00000175665] [ENSMUST00000176912]
Predicted Effect possibly damaging
Transcript: ENSMUST00000022707
AA Change: Q78L

PolyPhen 2 Score 0.911 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000022707
Gene: ENSMUSG00000022112
AA Change: Q78L

DomainStartEndE-ValueType
Pfam:Glypican 9 572 1.8e-182 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000175665
AA Change: Q151L

PolyPhen 2 Score 0.406 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000135857
Gene: ENSMUSG00000022112
AA Change: Q151L

DomainStartEndE-ValueType
Pfam:Glypican 82 480 1.3e-142 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000176912
AA Change: Q151L

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000135085
Gene: ENSMUSG00000022112
AA Change: Q151L

DomainStartEndE-ValueType
Pfam:Glypican 85 642 1.6e-174 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176993
Meta Mutation Damage Score 0.1394 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.4%
Validation Efficiency 100% (29/29)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Cell surface heparan sulfate proteoglycans are composed of a membrane-associated protein core substituted with a variable number of heparan sulfate chains. Members of the glypican-related integral membrane proteoglycan family (GRIPS) contain a core protein anchored to the cytoplasmic membrane via a glycosyl phosphatidylinositol linkage. These proteins may play a role in the control of cell division and growth regulation. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Atf5 T C 7: 44,813,497 T68A possibly damaging Het
Cage1 A G 13: 38,019,177 L637P possibly damaging Het
Cfl1 T C 19: 5,492,528 I12T probably benign Het
Clcn1 A G 6: 42,309,968 E653G probably damaging Het
Cntnap5a C A 1: 116,184,399 P473Q probably benign Het
Dnah7b T C 1: 46,081,495 S91P probably benign Het
Dusp27 T C 1: 166,100,111 D644G probably benign Het
Fcgbp A G 7: 28,113,979 Q2313R probably benign Het
Hexim1 A G 11: 103,117,106 E62G probably benign Het
Ifna13 A G 4: 88,643,991 F132S probably benign Het
Irgm2 A G 11: 58,220,130 M228V probably benign Het
Klhl41 A G 2: 69,670,710 M172V probably benign Het
Klk1 A T 7: 44,229,562 N260I probably damaging Het
Krit1 G C 5: 3,809,642 R110P probably damaging Het
Krt7 T A 15: 101,423,280 probably null Het
Lrrn4cl T A 19: 8,852,104 Y149N probably damaging Het
Ltbp3 G T 19: 5,751,871 C739F possibly damaging Het
Mbnl2 C T 14: 120,389,074 H239Y probably damaging Het
Obscn G A 11: 59,051,531 R4942* probably null Het
Olfr1344 T C 7: 6,440,689 L263P probably damaging Het
R3hcc1 A G 14: 69,706,662 S45P probably damaging Het
Ryr1 A T 7: 29,085,931 H1778Q possibly damaging Het
Scyl2 T A 10: 89,650,052 K558N probably damaging Het
Shank1 G A 7: 44,342,162 V677M unknown Het
Slc39a5 T C 10: 128,396,468 M488V possibly damaging Het
Styk1 A T 6: 131,312,917 probably null Het
Usp32 A G 11: 85,017,739 V1047A probably benign Het
Wnt3a G T 11: 59,249,644 H349N probably damaging Het
Zbtb39 T C 10: 127,743,554 C666R probably damaging Het
Zfp420 T C 7: 29,876,002 M549T probably benign Het
Other mutations in Gpc5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00419:Gpc5 APN 14 115370024 missense probably damaging 1.00
IGL01298:Gpc5 APN 14 115399188 missense probably benign 0.14
IGL01359:Gpc5 APN 14 115369750 missense possibly damaging 0.74
IGL02354:Gpc5 APN 14 115133287 nonsense probably null
IGL02361:Gpc5 APN 14 115133287 nonsense probably null
IGL02982:Gpc5 APN 14 115369988 missense probably damaging 1.00
IGL03120:Gpc5 APN 14 115370144 missense possibly damaging 0.64
R0322:Gpc5 UTSW 14 115399151 missense probably benign 0.05
R0396:Gpc5 UTSW 14 115428208 missense possibly damaging 0.91
R0555:Gpc5 UTSW 14 115552328 missense probably damaging 0.98
R0629:Gpc5 UTSW 14 115552239 missense possibly damaging 0.94
R1536:Gpc5 UTSW 14 115399250 missense probably benign 0.09
R1660:Gpc5 UTSW 14 115399279 missense probably benign 0.12
R1676:Gpc5 UTSW 14 115370098 missense probably damaging 1.00
R2328:Gpc5 UTSW 14 115788179 missense probably damaging 0.99
R3522:Gpc5 UTSW 14 116524335 missense probably benign 0.00
R3776:Gpc5 UTSW 14 115370060 missense probably benign 0.05
R3885:Gpc5 UTSW 14 115370060 missense probably benign 0.05
R3889:Gpc5 UTSW 14 115370060 missense probably benign 0.05
R3893:Gpc5 UTSW 14 115370060 missense probably benign 0.05
R4517:Gpc5 UTSW 14 115552239 missense possibly damaging 0.94
R5068:Gpc5 UTSW 14 115417264 makesense probably null
R5639:Gpc5 UTSW 14 115092747 missense probably benign 0.13
R5730:Gpc5 UTSW 14 115788314 missense possibly damaging 0.73
R5944:Gpc5 UTSW 14 115369838 missense probably benign 0.24
R6351:Gpc5 UTSW 14 115399200 missense probably benign 0.01
R6557:Gpc5 UTSW 14 115092534 unclassified probably benign
R6657:Gpc5 UTSW 14 115370198 missense probably benign 0.01
R6714:Gpc5 UTSW 14 115552303 nonsense probably null
R6751:Gpc5 UTSW 14 115369951 missense probably benign 0.00
R7057:Gpc5 UTSW 14 115133242 missense possibly damaging 0.64
R7142:Gpc5 UTSW 14 115417203 missense probably benign 0.01
R7225:Gpc5 UTSW 14 115552298 missense probably damaging 1.00
R7544:Gpc5 UTSW 14 115428173 missense probably damaging 1.00
R7658:Gpc5 UTSW 14 115428208 missense possibly damaging 0.91
R7695:Gpc5 UTSW 14 115092594 missense unknown
R7785:Gpc5 UTSW 14 115417220 missense probably benign 0.00
R8116:Gpc5 UTSW 14 115399225 missense probably damaging 0.98
R8303:Gpc5 UTSW 14 115428255 missense probably benign 0.01
RF001:Gpc5 UTSW 14 115417178 missense probably benign 0.41
RF022:Gpc5 UTSW 14 115552276 missense probably damaging 1.00
Z1176:Gpc5 UTSW 14 115369964 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACCTCTAGCATGCAGGGTTG -3'
(R):5'- CTGTCGTATTCAATATCCACTCAG -3'

Sequencing Primer
(F):5'- GGTTAGTCATAACATTTGCCCTG -3'
(R):5'- GCCTCCATACATAATTTATGATGGC -3'
Posted On2015-04-30