Mutagenetix > Incidental Mutations

Incidental Mutation 'R4043:Myo3a'

313905

Institutional Source

Beutler Lab

Gene Symbol

Myo3a

Ensembl Gene

ENSMUSG00000025716

Gene Name

myosin IIIA

Synonyms

9030416P08Rik

MMRRC Submission

041615-MU

Accession Numbers

Genbank: NM_148413; MGI: 2183924

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R4043 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

22227503-22618252 bp(+) (GRCm38)

Type of Mutation

splice site

DNA Base Change (assembly)

C to T at 22333539 bp

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000120573 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000044749] [ENSMUST00000153002]

Predicted Effect

probably benign
Transcript: ENSMUST00000044749

SMART Domains

Protein: ENSMUSP00000046329
Gene: ENSMUSG00000025716

Domain	Start	End	E-Value	Type
S_TKc	29	295	1.62e-91	SMART
MYSc	340	1061	2.07e-252	SMART
IQ	1061	1083	2.88e1	SMART
IQ	1088	1110	9.48e-3	SMART
low complexity region	1153	1169	N/A	INTRINSIC
low complexity region	1359	1369	N/A	INTRINSIC
low complexity region	1496	1505	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000153002

SMART Domains

Protein: ENSMUSP00000120573
Gene: ENSMUSG00000025716

Domain	Start	End	E-Value	Type
S_TKc	21	287	1.62e-91	SMART
MYSc	332	753	3.06e-35	SMART

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.1%
3x: 98.4%
10x: 96.7%
20x: 92.9%

Validation Efficiency

97% (64/66)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the myosin superfamily. Myosins are actin-dependent motor proteins and are categorized into conventional myosins (class II) and unconventional myosins (classes I and III through XV) based on their variable C-terminal cargo-binding domains. Class III myosins, such as this one, have a kinase domain N-terminal to the conserved N-terminal motor domains and are expressed in photoreceptors. The protein encoded by this gene plays an important role in hearing in humans. Three different recessive, loss of function mutations in the encoded protein have been shown to cause nonsyndromic progressive hearing loss. Expression of this gene is highly restricted, with the strongest expression in retina and cochlea. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-in allele exhibit impaired hearing and cochlear hair cell degeneration. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 64 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4430402I18Rik	A	T	19: 28,945,783	C80S	possibly damaging	Het
4930415L06Rik	A	G	X: 89,932,303	F96S	probably damaging	Het
Adgrf3	T	C	5: 30,204,362	N44D	probably benign	Het
AU018091	A	G	7: 3,159,122	F375L	probably damaging	Het
Bsph1	G	T	7: 13,458,276		probably null	Het
Casp1	A	G	9: 5,302,444	D122G	probably benign	Het
Ccdc146	C	T	5: 21,316,943	C361Y	probably benign	Het
Cdc37l1	T	C	19: 28,990,628	S31P	possibly damaging	Het
Cdca2	A	T	14: 67,704,006	M249K	probably benign	Het
Cfap73	C	T	5: 120,629,965		probably null	Het
Cgnl1	A	G	9: 71,705,293	L749S	probably damaging	Het
Cmtr2	C	A	8: 110,221,830	C257*	probably null	Het
Col6a4	A	T	9: 106,072,411	L675*	probably null	Het
Cpne8	A	T	15: 90,572,001	D186E	probably damaging	Het
Csmd3	A	G	15: 47,755,966		probably null	Het
D330045A20Rik	C	T	X: 139,507,003	S364L	probably damaging	Het
D430042O09Rik	A	G	7: 125,868,741	I1366V	probably benign	Het
Daglb	T	A	5: 143,487,151	Y354N	possibly damaging	Het
Dlgap1	T	C	17: 70,761,080	S549P	probably damaging	Het
Dnah11	T	C	12: 117,879,943	D4389G	probably damaging	Het
Dst	T	A	1: 34,190,684	C2631S	probably benign	Het
Gimap1	T	A	6: 48,743,242	W263R	probably damaging	Het
Gne	A	C	4: 44,040,383	C594G	possibly damaging	Het
Gtf2a1	T	C	12: 91,575,667	H47R	probably benign	Het
Hdac6	T	C	X: 7,931,492	T993A	probably benign	Het
Helz2	T	C	2: 181,229,710	D2703G	probably benign	Het
Jmjd1c	G	A	10: 67,219,466	V222I	possibly damaging	Het
Kndc1	A	G	7: 139,924,129	E1116G	probably benign	Het
Krt10	C	T	11: 99,386,993		probably null	Het
Lrrc37a	T	G	11: 103,498,653	H1982P	possibly damaging	Het
Med13l	T	A	5: 118,593,463	L68Q	probably damaging	Het
Megf10	C	A	18: 57,259,798	D422E	probably damaging	Het
Mpz	C	T	1: 171,159,771		probably benign	Het
Muc5ac	A	T	7: 141,807,478	T1508S	possibly damaging	Het
Ndnf	A	T	6: 65,703,936	N400Y	possibly damaging	Het
Olfr192	G	A	16: 59,098,761	T77I	unknown	Het
Olfr414	T	C	1: 174,431,091	I221T	probably damaging	Het
Olfr855	G	T	9: 19,584,995	V153F	probably benign	Het
Otol1	A	G	3: 70,027,779	D368G	probably damaging	Het
Pappa	A	G	4: 65,314,587	N1321S	probably benign	Het
Patl1	T	A	19: 11,942,950	L756Q	probably damaging	Het
Plcg2	A	G	8: 117,612,978	M1043V	probably benign	Het
Plekhg2	G	A	7: 28,364,719		probably benign	Het
Ppp2r2d	G	A	7: 138,882,416	W265*	probably null	Het
Prss40	G	T	1: 34,560,879	S9*	probably null	Het
Radil	T	A	5: 142,494,233	I471F	probably benign	Het
Rpl10l	A	T	12: 66,284,203	M52K	probably damaging	Het
Scn1a	A	T	2: 66,326,036	S510T	possibly damaging	Het
Sdad1	T	G	5: 92,302,694	N194T	probably damaging	Het
Sel1l3	A	T	5: 53,188,054	Y259*	probably null	Het
Slc22a26	T	C	19: 7,788,329		probably null	Het
Snap91	C	T	9: 86,777,049	G477D	probably damaging	Het
Srr	T	C	11: 74,909,121	T202A	probably benign	Het
Srrm1	C	T	4: 135,340,931		probably benign	Het
Trp53bp2	T	A	1: 182,449,061	L869Q	possibly damaging	Het
Ttbk1	T	A	17: 46,446,762	D982V	probably benign	Het
Ttn	T	C	2: 76,794,157	T15324A	probably benign	Het
Ush1c	T	C	7: 46,221,528	E276G	probably damaging	Het
Vcan	T	A	13: 89,692,543	L1627F	probably benign	Het
Vps8	A	C	16: 21,526,396	D823A	probably damaging	Het
Zfp616	T	A	11: 74,085,282	N792K	possibly damaging	Het
Zfpm2	A	T	15: 40,870,627	D2V	possibly damaging	Het
Zfyve16	A	C	13: 92,513,763		probably null	Het
Zmym2	T	A	14: 56,958,308		probably benign	Het

Other mutations in Myo3a

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01014:Myo3a	APN	2	22332473	missense	probably benign	0.42
IGL01307:Myo3a	APN	2	22558289	missense	probably damaging	1.00
IGL01413:Myo3a	APN	2	22297600	missense	probably benign	0.25
IGL01655:Myo3a	APN	2	22423326	missense	probably damaging	1.00
IGL01767:Myo3a	APN	2	22423222	missense	probably damaging	0.96
IGL01803:Myo3a	APN	2	22241115	missense	probably damaging	1.00
IGL01969:Myo3a	APN	2	22297688	missense	probably benign	0.03
IGL02043:Myo3a	APN	2	22399965	missense	probably benign	0.01
IGL02124:Myo3a	APN	2	22577526	missense	probably benign	0.01
IGL02174:Myo3a	APN	2	22332393	missense	probably benign	0.04
IGL02649:Myo3a	APN	2	22323607	missense	probably benign
IGL02976:Myo3a	APN	2	22542452	nonsense	probably null
IGL03328:Myo3a	APN	2	22578198	missense	probably benign	0.02
IGL03376:Myo3a	APN	2	22600074	splice site	probably benign
lose	UTSW	2	22558320	nonsense	probably null
snooze	UTSW	2	22282634	missense	probably damaging	0.99
A5278:Myo3a	UTSW	2	22323653	missense	probably benign	0.27
PIT4445001:Myo3a	UTSW	2	22542415	missense	possibly damaging	0.64
R0008:Myo3a	UTSW	2	22579741	missense	probably damaging	0.99
R0099:Myo3a	UTSW	2	22245598	missense	probably benign	0.03
R0103:Myo3a	UTSW	2	22544322	splice site	probably benign
R0103:Myo3a	UTSW	2	22544322	splice site	probably benign
R0212:Myo3a	UTSW	2	22291848	missense	probably damaging	1.00
R0281:Myo3a	UTSW	2	22245598	missense	probably benign	0.03
R0282:Myo3a	UTSW	2	22245598	missense	probably benign	0.03
R0492:Myo3a	UTSW	2	22323636	missense	possibly damaging	0.46
R0498:Myo3a	UTSW	2	22577429	missense	possibly damaging	0.74
R0594:Myo3a	UTSW	2	22544332	splice site	probably benign
R0609:Myo3a	UTSW	2	22333513	missense	probably benign	0.29
R0609:Myo3a	UTSW	2	22396299	missense	possibly damaging	0.95
R0827:Myo3a	UTSW	2	22558215	missense	probably damaging	1.00
R0968:Myo3a	UTSW	2	22558289	missense	probably damaging	1.00
R1157:Myo3a	UTSW	2	22542414	critical splice acceptor site	probably null
R1301:Myo3a	UTSW	2	22267095	splice site	probably benign
R1352:Myo3a	UTSW	2	22323675	critical splice donor site	probably null
R1443:Myo3a	UTSW	2	22282626	missense	probably damaging	0.99
R1465:Myo3a	UTSW	2	22577927	missense	probably benign	0.00
R1465:Myo3a	UTSW	2	22577927	missense	probably benign	0.00
R1517:Myo3a	UTSW	2	22282634	missense	probably damaging	0.99
R1565:Myo3a	UTSW	2	22340280	missense	probably damaging	1.00
R1712:Myo3a	UTSW	2	22564992	missense	probably damaging	1.00
R1722:Myo3a	UTSW	2	22399827	missense	probably benign	0.03
R1822:Myo3a	UTSW	2	22340280	missense	probably damaging	1.00
R1823:Myo3a	UTSW	2	22340280	missense	probably damaging	1.00
R1824:Myo3a	UTSW	2	22396243	missense	probably benign
R1837:Myo3a	UTSW	2	22577592	missense	possibly damaging	0.76
R1867:Myo3a	UTSW	2	22399846	missense	probably benign	0.00
R1917:Myo3a	UTSW	2	22291922	missense	probably damaging	1.00
R1920:Myo3a	UTSW	2	22564996	missense	probably benign	0.02
R1937:Myo3a	UTSW	2	22396315	missense	probably damaging	1.00
R1954:Myo3a	UTSW	2	22241226	missense	probably damaging	1.00
R1988:Myo3a	UTSW	2	22578128	missense	possibly damaging	0.86
R2091:Myo3a	UTSW	2	22333677	missense	probably damaging	0.99
R2115:Myo3a	UTSW	2	22245531	missense	probably damaging	1.00
R2125:Myo3a	UTSW	2	22578174	missense	probably benign	0.42
R2126:Myo3a	UTSW	2	22578174	missense	probably benign	0.42
R2216:Myo3a	UTSW	2	22577771	missense	probably benign	0.00
R2413:Myo3a	UTSW	2	22577912	missense	probably benign	0.00
R2964:Myo3a	UTSW	2	22340256	missense	possibly damaging	0.90
R3196:Myo3a	UTSW	2	22399868	missense	possibly damaging	0.86
R3837:Myo3a	UTSW	2	22565109	splice site	probably benign
R3905:Myo3a	UTSW	2	22558215	missense	probably damaging	1.00
R3926:Myo3a	UTSW	2	22565041	missense	probably damaging	0.99
R4014:Myo3a	UTSW	2	22578170	missense	possibly damaging	0.76
R4015:Myo3a	UTSW	2	22578170	missense	possibly damaging	0.76
R4017:Myo3a	UTSW	2	22578170	missense	possibly damaging	0.76
R4044:Myo3a	UTSW	2	22577700	missense	probably damaging	0.99
R4057:Myo3a	UTSW	2	22266160	missense	probably benign	0.01
R4192:Myo3a	UTSW	2	22407377	missense	probably damaging	1.00
R4282:Myo3a	UTSW	2	22340278	missense	probably benign	0.14
R4321:Myo3a	UTSW	2	22267155	missense	probably damaging	1.00
R4393:Myo3a	UTSW	2	22577854	missense	probably damaging	0.99
R4398:Myo3a	UTSW	2	22577842	missense	probably benign
R4446:Myo3a	UTSW	2	22600137	missense	probably damaging	1.00
R4685:Myo3a	UTSW	2	22407422	missense	probably damaging	1.00
R5032:Myo3a	UTSW	2	22282602	missense	probably damaging	1.00
R5096:Myo3a	UTSW	2	22574242	missense	probably benign	0.16
R5183:Myo3a	UTSW	2	22578158	missense	probably benign	0.05
R5458:Myo3a	UTSW	2	22245550	missense	probably damaging	1.00
R5502:Myo3a	UTSW	2	22558369	missense	probably damaging	1.00
R5522:Myo3a	UTSW	2	22574341	missense	probably damaging	1.00
R6462:Myo3a	UTSW	2	22558411	missense	probably damaging	1.00
R6479:Myo3a	UTSW	2	22577865	missense	probably benign	0.00
R6513:Myo3a	UTSW	2	22407332	missense	probably damaging	1.00
R6520:Myo3a	UTSW	2	22399926	missense	possibly damaging	0.90
R6602:Myo3a	UTSW	2	22577787	missense	probably damaging	0.96
R6671:Myo3a	UTSW	2	22294522	missense	probably damaging	1.00
R6743:Myo3a	UTSW	2	22361664	missense	probably benign	0.24
R6865:Myo3a	UTSW	2	22574301	missense	probably benign	0.00
R6961:Myo3a	UTSW	2	22245558	missense	probably benign	0.00
R7001:Myo3a	UTSW	2	22332377	missense	probably benign	0.04
R7215:Myo3a	UTSW	2	22245567	missense	possibly damaging	0.78
R7301:Myo3a	UTSW	2	22544466	critical splice donor site	probably null
R7318:Myo3a	UTSW	2	22558320	nonsense	probably null
R7447:Myo3a	UTSW	2	22544426	missense	probably benign	0.27
R7456:Myo3a	UTSW	2	22407444	missense	probably benign	0.08
R7528:Myo3a	UTSW	2	22266114	nonsense	probably null
R7731:Myo3a	UTSW	2	22282589	missense	probably damaging	1.00
R7768:Myo3a	UTSW	2	22241143	missense	probably damaging	0.99
R8054:Myo3a	UTSW	2	22574317	missense	probably benign	0.00
R8140:Myo3a	UTSW	2	22407346	missense	probably damaging	1.00
R8143:Myo3a	UTSW	2	22282665	critical splice donor site	probably null
R8346:Myo3a	UTSW	2	22558422	critical splice donor site	probably null
R8421:Myo3a	UTSW	2	22362124	missense	probably benign	0.07
R8495:Myo3a	UTSW	2	22396273	missense	probably damaging	0.96
R8551:Myo3a	UTSW	2	22332466	missense	probably benign	0.00
Z1177:Myo3a	UTSW	2	22618140	missense	possibly damaging	0.58

Predicted Primers

PCR Primer
(F):5'- GGAAAGATGTCACATGTCAGAC -3'
(R):5'- CTACCTTTCCAAGCACAGTGAG -3'

Sequencing Primer
(F):5'- AATAATCACATTTTGAAGCCTTAAGC -3'
(R):5'- GCTGTTGAACCAGAAGATGAGC -3'

Posted On

2015-04-30