Incidental Mutation 'R0388:Olfr1040'
ID31391
Institutional Source Beutler Lab
Gene Symbol Olfr1040
Ensembl Gene ENSMUSG00000075203
Gene Nameolfactory receptor 1040
SynonymsMOR185-12, GA_x6K02T2Q125-47615732-47614791
MMRRC Submission 038594-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.115) question?
Stock #R0388 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location86145791-86146732 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 86146630 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 35 (Y35H)
Ref Sequence ENSEMBL: ENSMUSP00000097493 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099909]
Predicted Effect probably damaging
Transcript: ENSMUST00000099909
AA Change: Y35H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000097493
Gene: ENSMUSG00000075203
AA Change: Y35H

DomainStartEndE-ValueType
Pfam:7tm_4 31 307 8.2e-48 PFAM
Pfam:7tm_1 41 290 5.1e-16 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000215884
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.0%
  • 10x: 95.6%
  • 20x: 90.7%
Validation Efficiency 100% (67/67)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010315B03Rik T C 9: 124,295,159 probably benign Het
Acsbg1 T C 9: 54,609,063 K678R probably damaging Het
Adgrg6 A G 10: 14,450,658 I410T probably benign Het
Afap1l2 A C 19: 56,917,242 probably benign Het
Aox2 T C 1: 58,354,406 Y1242H probably damaging Het
Apoo-ps T C 13: 107,414,673 noncoding transcript Het
Camta1 C A 4: 151,075,140 R1614L probably damaging Het
Cdh3 C A 8: 106,539,129 T268K probably damaging Het
Chd5 T A 4: 152,371,644 H923Q probably damaging Het
Chd7 T C 4: 8,854,560 V1967A probably benign Het
Cntn3 T C 6: 102,277,316 M222V probably damaging Het
Dcaf17 A G 2: 71,078,571 K277R probably benign Het
Dmbt1 T C 7: 131,096,049 probably benign Het
Dmpk T A 7: 19,084,077 probably benign Het
Dzank1 A T 2: 144,476,106 L714Q possibly damaging Het
Efcab3 A G 11: 105,109,401 D272G possibly damaging Het
Erbb2 G C 11: 98,427,351 R471P possibly damaging Het
Esf1 T A 2: 140,120,871 Y760F possibly damaging Het
Fanci C A 7: 79,439,630 T938K probably benign Het
Gnai3 A G 3: 108,115,757 probably benign Het
Hspg2 T A 4: 137,511,158 C319S probably damaging Het
Il12a T A 3: 68,695,187 probably null Het
Inpp4a A G 1: 37,396,160 D837G probably damaging Het
Kcnj5 T A 9: 32,317,863 E13V probably damaging Het
Kcnq3 T A 15: 66,000,038 Y594F probably benign Het
Kif16b T C 2: 142,740,937 E556G probably damaging Het
Kif28 T C 1: 179,740,089 I39V possibly damaging Het
Lgi2 T C 5: 52,554,549 E143G probably damaging Het
Mast1 T G 8: 84,915,537 I1063L probably benign Het
Med12l T C 3: 59,093,504 probably benign Het
Mmp19 G T 10: 128,798,883 R456L probably benign Het
Mon1b T A 8: 113,639,078 V346E probably damaging Het
Mpv17l A T 16: 13,940,999 I96L probably benign Het
Mrgpra9 A T 7: 47,252,794 M1K probably null Het
Mycbp2 A T 14: 103,156,667 H2819Q probably benign Het
Nav1 A C 1: 135,448,917 probably benign Het
Neurl4 T C 11: 69,911,733 probably benign Het
Ntng2 G C 2: 29,207,426 P341R probably damaging Het
Oas1d A T 5: 120,917,028 Y221F probably damaging Het
Olfr348 C A 2: 36,786,862 D112E probably benign Het
Olfr365 A C 2: 37,202,184 probably null Het
Osbpl8 A G 10: 111,272,282 M380V probably benign Het
Pank1 T C 19: 34,821,706 probably benign Het
Parn T C 16: 13,654,476 D169G possibly damaging Het
Pknox1 T A 17: 31,603,192 I311N probably damaging Het
Pprc1 T C 19: 46,062,775 V248A possibly damaging Het
Prkcq T C 2: 11,254,234 C322R probably benign Het
Ptpn13 T A 5: 103,555,062 I1298N probably benign Het
Rab11fip3 A G 17: 26,069,072 S36P probably benign Het
Rif1 GCCACCA GCCA 2: 52,110,324 probably benign Het
Sass6 C A 3: 116,607,308 probably benign Het
Shroom3 G A 5: 92,951,293 G1463D probably benign Het
Slc35d1 A T 4: 103,184,887 Y249* probably null Het
Slc9a3 C T 13: 74,121,536 P8S unknown Het
Slc9a9 T A 9: 94,939,563 probably null Het
Syne2 T A 12: 75,986,975 M3666K probably benign Het
Synpo2 A G 3: 123,079,897 V1140A probably benign Het
Thada A G 17: 84,231,096 F1495L probably benign Het
Timeless A G 10: 128,241,425 probably null Het
Tlr6 G T 5: 64,955,205 H120N possibly damaging Het
Tmem173 A G 18: 35,735,111 probably null Het
Tns3 T C 11: 8,445,703 I1234V probably benign Het
Ttll9 A G 2: 153,000,179 S318G probably benign Het
Vps13c T C 9: 67,922,915 probably benign Het
Zfp933 T C 4: 147,826,442 I232M probably benign Het
Zfyve27 T C 19: 42,189,585 S382P probably damaging Het
Other mutations in Olfr1040
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01081:Olfr1040 APN 2 86146611 missense probably benign 0.22
IGL01106:Olfr1040 APN 2 86146216 missense probably benign 0.09
IGL02193:Olfr1040 APN 2 86146715 missense probably benign 0.00
IGL02730:Olfr1040 APN 2 86146099 missense probably benign 0.05
IGL03032:Olfr1040 APN 2 86146699 missense probably damaging 1.00
IGL03165:Olfr1040 APN 2 86146068 missense possibly damaging 0.91
R2971:Olfr1040 UTSW 2 86146564 missense probably damaging 0.96
R4168:Olfr1040 UTSW 2 86146179 missense probably benign 0.03
R4532:Olfr1040 UTSW 2 86145930 missense possibly damaging 0.77
R5024:Olfr1040 UTSW 2 86146533 missense probably damaging 1.00
R5175:Olfr1040 UTSW 2 86145957 missense probably damaging 1.00
R5574:Olfr1040 UTSW 2 86146191 missense probably damaging 1.00
R6033:Olfr1040 UTSW 2 86146269 missense probably damaging 0.97
R6033:Olfr1040 UTSW 2 86146269 missense probably damaging 0.97
R6137:Olfr1040 UTSW 2 86145969 missense probably benign
R6945:Olfr1040 UTSW 2 86146084 missense probably damaging 1.00
R6980:Olfr1040 UTSW 2 86146337 nonsense probably null
R7065:Olfr1040 UTSW 2 86146001 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCCAGCAATGATTAGCAACATCAGC -3'
(R):5'- CACTTGGAATGAGTGTGGTGACTCC -3'

Sequencing Primer
(F):5'- CTTTTTAGGCATGAGGACCAC -3'
(R):5'- GTGACTCCTTTTGAGTGGTAAACAC -3'
Posted On2013-04-24