Incidental Mutation 'R0388:Or5al6'
ID 31391
Institutional Source Beutler Lab
Gene Symbol Or5al6
Ensembl Gene ENSMUSG00000075203
Gene Name olfactory receptor family 5 subfamily AL member 6
Synonyms Olfr1040, MOR185-12, GA_x6K02T2Q125-47615732-47614791
MMRRC Submission 038594-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.181) question?
Stock # R0388 (G1)
Quality Score 225
Status Validated
Chromosome 2
Chromosomal Location 85976135-85977076 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 85976974 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Histidine at position 35 (Y35H)
Ref Sequence ENSEMBL: ENSMUSP00000097493 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099909]
AlphaFold A2ARY1
Predicted Effect probably damaging
Transcript: ENSMUST00000099909
AA Change: Y35H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000097493
Gene: ENSMUSG00000075203
AA Change: Y35H

DomainStartEndE-ValueType
Pfam:7tm_4 31 307 8.2e-48 PFAM
Pfam:7tm_1 41 290 5.1e-16 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000215884
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.0%
  • 10x: 95.6%
  • 20x: 90.7%
Validation Efficiency 100% (67/67)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010315B03Rik T C 9: 124,057,789 (GRCm39) probably benign Het
Acsbg1 T C 9: 54,516,347 (GRCm39) K678R probably damaging Het
Adgrg6 A G 10: 14,326,402 (GRCm39) I410T probably benign Het
Afap1l2 A C 19: 56,905,674 (GRCm39) probably benign Het
Aox1 T C 1: 58,393,565 (GRCm39) Y1242H probably damaging Het
Apoo-ps T C 13: 107,551,173 (GRCm39) noncoding transcript Het
Camta1 C A 4: 151,159,597 (GRCm39) R1614L probably damaging Het
Cdh3 C A 8: 107,265,761 (GRCm39) T268K probably damaging Het
Chd5 T A 4: 152,456,101 (GRCm39) H923Q probably damaging Het
Chd7 T C 4: 8,854,560 (GRCm39) V1967A probably benign Het
Cntn3 T C 6: 102,254,277 (GRCm39) M222V probably damaging Het
Dcaf17 A G 2: 70,908,915 (GRCm39) K277R probably benign Het
Dmbt1 T C 7: 130,697,779 (GRCm39) probably benign Het
Dmpk T A 7: 18,818,002 (GRCm39) probably benign Het
Dzank1 A T 2: 144,318,026 (GRCm39) L714Q possibly damaging Het
Efcab3 A G 11: 105,000,227 (GRCm39) D272G possibly damaging Het
Erbb2 G C 11: 98,318,177 (GRCm39) R471P possibly damaging Het
Esf1 T A 2: 139,962,791 (GRCm39) Y760F possibly damaging Het
Fanci C A 7: 79,089,378 (GRCm39) T938K probably benign Het
Gnai3 A G 3: 108,023,073 (GRCm39) probably benign Het
Hspg2 T A 4: 137,238,469 (GRCm39) C319S probably damaging Het
Il12a T A 3: 68,602,520 (GRCm39) probably null Het
Inpp4a A G 1: 37,435,241 (GRCm39) D837G probably damaging Het
Kcnj5 T A 9: 32,229,159 (GRCm39) E13V probably damaging Het
Kcnq3 T A 15: 65,871,887 (GRCm39) Y594F probably benign Het
Kif16b T C 2: 142,582,857 (GRCm39) E556G probably damaging Het
Kif28 T C 1: 179,567,654 (GRCm39) I39V possibly damaging Het
Lgi2 T C 5: 52,711,891 (GRCm39) E143G probably damaging Het
Mast1 T G 8: 85,642,166 (GRCm39) I1063L probably benign Het
Med12l T C 3: 59,000,925 (GRCm39) probably benign Het
Mmp19 G T 10: 128,634,752 (GRCm39) R456L probably benign Het
Mon1b T A 8: 114,365,710 (GRCm39) V346E probably damaging Het
Mpv17l A T 16: 13,758,863 (GRCm39) I96L probably benign Het
Mrgpra9 A T 7: 46,902,542 (GRCm39) M1K probably null Het
Mycbp2 A T 14: 103,394,103 (GRCm39) H2819Q probably benign Het
Nav1 A C 1: 135,376,655 (GRCm39) probably benign Het
Neurl4 T C 11: 69,802,559 (GRCm39) probably benign Het
Ntng2 G C 2: 29,097,438 (GRCm39) P341R probably damaging Het
Oas1d A T 5: 121,055,091 (GRCm39) Y221F probably damaging Het
Or1j19 C A 2: 36,676,874 (GRCm39) D112E probably benign Het
Or1l4 A C 2: 37,092,196 (GRCm39) probably null Het
Osbpl8 A G 10: 111,108,143 (GRCm39) M380V probably benign Het
Pank1 T C 19: 34,799,106 (GRCm39) probably benign Het
Parn T C 16: 13,472,340 (GRCm39) D169G possibly damaging Het
Pknox1 T A 17: 31,822,166 (GRCm39) I311N probably damaging Het
Pprc1 T C 19: 46,051,214 (GRCm39) V248A possibly damaging Het
Prkcq T C 2: 11,259,045 (GRCm39) C322R probably benign Het
Ptpn13 T A 5: 103,702,928 (GRCm39) I1298N probably benign Het
Rab11fip3 A G 17: 26,288,046 (GRCm39) S36P probably benign Het
Rif1 GCCACCA GCCA 2: 52,000,336 (GRCm39) probably benign Het
Sass6 C A 3: 116,400,957 (GRCm39) probably benign Het
Shroom3 G A 5: 93,099,152 (GRCm39) G1463D probably benign Het
Slc35d1 A T 4: 103,042,084 (GRCm39) Y249* probably null Het
Slc9a3 C T 13: 74,269,655 (GRCm39) P8S unknown Het
Slc9a9 T A 9: 94,821,616 (GRCm39) probably null Het
Sting1 A G 18: 35,868,164 (GRCm39) probably null Het
Syne2 T A 12: 76,033,749 (GRCm39) M3666K probably benign Het
Synpo2 A G 3: 122,873,546 (GRCm39) V1140A probably benign Het
Thada A G 17: 84,538,524 (GRCm39) F1495L probably benign Het
Timeless A G 10: 128,077,294 (GRCm39) probably null Het
Tlr6 G T 5: 65,112,548 (GRCm39) H120N possibly damaging Het
Tns3 T C 11: 8,395,703 (GRCm39) I1234V probably benign Het
Ttll9 A G 2: 152,842,099 (GRCm39) S318G probably benign Het
Vps13c T C 9: 67,830,197 (GRCm39) probably benign Het
Zfp933 T C 4: 147,910,899 (GRCm39) I232M probably benign Het
Zfyve27 T C 19: 42,178,024 (GRCm39) S382P probably damaging Het
Other mutations in Or5al6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01081:Or5al6 APN 2 85,976,955 (GRCm39) missense probably benign 0.22
IGL01106:Or5al6 APN 2 85,976,560 (GRCm39) missense probably benign 0.09
IGL02193:Or5al6 APN 2 85,977,059 (GRCm39) missense probably benign 0.00
IGL02730:Or5al6 APN 2 85,976,443 (GRCm39) missense probably benign 0.05
IGL03032:Or5al6 APN 2 85,977,043 (GRCm39) missense probably damaging 1.00
IGL03165:Or5al6 APN 2 85,976,412 (GRCm39) missense possibly damaging 0.91
R2971:Or5al6 UTSW 2 85,976,908 (GRCm39) missense probably damaging 0.96
R4168:Or5al6 UTSW 2 85,976,523 (GRCm39) missense probably benign 0.03
R4532:Or5al6 UTSW 2 85,976,274 (GRCm39) missense possibly damaging 0.77
R5024:Or5al6 UTSW 2 85,976,877 (GRCm39) missense probably damaging 1.00
R5175:Or5al6 UTSW 2 85,976,301 (GRCm39) missense probably damaging 1.00
R5574:Or5al6 UTSW 2 85,976,535 (GRCm39) missense probably damaging 1.00
R6033:Or5al6 UTSW 2 85,976,613 (GRCm39) missense probably damaging 0.97
R6033:Or5al6 UTSW 2 85,976,613 (GRCm39) missense probably damaging 0.97
R6137:Or5al6 UTSW 2 85,976,313 (GRCm39) missense probably benign
R6945:Or5al6 UTSW 2 85,976,428 (GRCm39) missense probably damaging 1.00
R6980:Or5al6 UTSW 2 85,976,681 (GRCm39) nonsense probably null
R7065:Or5al6 UTSW 2 85,976,345 (GRCm39) missense probably damaging 1.00
R8264:Or5al6 UTSW 2 85,976,538 (GRCm39) missense probably damaging 1.00
R9039:Or5al6 UTSW 2 85,976,625 (GRCm39) missense probably damaging 1.00
R9224:Or5al6 UTSW 2 85,976,220 (GRCm39) missense probably damaging 1.00
R9745:Or5al6 UTSW 2 85,976,251 (GRCm39) missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GCCAGCAATGATTAGCAACATCAGC -3'
(R):5'- CACTTGGAATGAGTGTGGTGACTCC -3'

Sequencing Primer
(F):5'- CTTTTTAGGCATGAGGACCAC -3'
(R):5'- GTGACTCCTTTTGAGTGGTAAACAC -3'
Posted On 2013-04-24