Incidental Mutation 'R0388:Esf1'
ID31392
Institutional Source Beutler Lab
Gene Symbol Esf1
Ensembl Gene ENSMUSG00000045624
Gene NameESF1 nucleolar pre-rRNA processing protein homolog
Synonyms
MMRRC Submission 038594-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.939) question?
Stock #R0388 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location140119883-140170564 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 140120871 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Phenylalanine at position 760 (Y760F)
Ref Sequence ENSEMBL: ENSMUSP00000036523 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046030]
Predicted Effect possibly damaging
Transcript: ENSMUST00000046030
AA Change: Y760F

PolyPhen 2 Score 0.707 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000036523
Gene: ENSMUSG00000045624
AA Change: Y760F

DomainStartEndE-ValueType
coiled coil region 91 114 N/A INTRINSIC
low complexity region 192 207 N/A INTRINSIC
low complexity region 230 258 N/A INTRINSIC
coiled coil region 261 293 N/A INTRINSIC
low complexity region 539 552 N/A INTRINSIC
coiled coil region 628 652 N/A INTRINSIC
low complexity region 667 692 N/A INTRINSIC
low complexity region 730 740 N/A INTRINSIC
Pfam:NUC153 753 781 4.1e-15 PFAM
low complexity region 784 798 N/A INTRINSIC
Meta Mutation Damage Score 0.0650 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.0%
  • 10x: 95.6%
  • 20x: 90.7%
Validation Efficiency 100% (67/67)
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010315B03Rik T C 9: 124,295,159 probably benign Het
Acsbg1 T C 9: 54,609,063 K678R probably damaging Het
Adgrg6 A G 10: 14,450,658 I410T probably benign Het
Afap1l2 A C 19: 56,917,242 probably benign Het
Aox2 T C 1: 58,354,406 Y1242H probably damaging Het
Apoo-ps T C 13: 107,414,673 noncoding transcript Het
Camta1 C A 4: 151,075,140 R1614L probably damaging Het
Cdh3 C A 8: 106,539,129 T268K probably damaging Het
Chd5 T A 4: 152,371,644 H923Q probably damaging Het
Chd7 T C 4: 8,854,560 V1967A probably benign Het
Cntn3 T C 6: 102,277,316 M222V probably damaging Het
Dcaf17 A G 2: 71,078,571 K277R probably benign Het
Dmbt1 T C 7: 131,096,049 probably benign Het
Dmpk T A 7: 19,084,077 probably benign Het
Dzank1 A T 2: 144,476,106 L714Q possibly damaging Het
Efcab3 A G 11: 105,109,401 D272G possibly damaging Het
Erbb2 G C 11: 98,427,351 R471P possibly damaging Het
Fanci C A 7: 79,439,630 T938K probably benign Het
Gnai3 A G 3: 108,115,757 probably benign Het
Hspg2 T A 4: 137,511,158 C319S probably damaging Het
Il12a T A 3: 68,695,187 probably null Het
Inpp4a A G 1: 37,396,160 D837G probably damaging Het
Kcnj5 T A 9: 32,317,863 E13V probably damaging Het
Kcnq3 T A 15: 66,000,038 Y594F probably benign Het
Kif16b T C 2: 142,740,937 E556G probably damaging Het
Kif28 T C 1: 179,740,089 I39V possibly damaging Het
Lgi2 T C 5: 52,554,549 E143G probably damaging Het
Mast1 T G 8: 84,915,537 I1063L probably benign Het
Med12l T C 3: 59,093,504 probably benign Het
Mmp19 G T 10: 128,798,883 R456L probably benign Het
Mon1b T A 8: 113,639,078 V346E probably damaging Het
Mpv17l A T 16: 13,940,999 I96L probably benign Het
Mrgpra9 A T 7: 47,252,794 M1K probably null Het
Mycbp2 A T 14: 103,156,667 H2819Q probably benign Het
Nav1 A C 1: 135,448,917 probably benign Het
Neurl4 T C 11: 69,911,733 probably benign Het
Ntng2 G C 2: 29,207,426 P341R probably damaging Het
Oas1d A T 5: 120,917,028 Y221F probably damaging Het
Olfr1040 A G 2: 86,146,630 Y35H probably damaging Het
Olfr348 C A 2: 36,786,862 D112E probably benign Het
Olfr365 A C 2: 37,202,184 probably null Het
Osbpl8 A G 10: 111,272,282 M380V probably benign Het
Pank1 T C 19: 34,821,706 probably benign Het
Parn T C 16: 13,654,476 D169G possibly damaging Het
Pknox1 T A 17: 31,603,192 I311N probably damaging Het
Pprc1 T C 19: 46,062,775 V248A possibly damaging Het
Prkcq T C 2: 11,254,234 C322R probably benign Het
Ptpn13 T A 5: 103,555,062 I1298N probably benign Het
Rab11fip3 A G 17: 26,069,072 S36P probably benign Het
Rif1 GCCACCA GCCA 2: 52,110,324 probably benign Het
Sass6 C A 3: 116,607,308 probably benign Het
Shroom3 G A 5: 92,951,293 G1463D probably benign Het
Slc35d1 A T 4: 103,184,887 Y249* probably null Het
Slc9a3 C T 13: 74,121,536 P8S unknown Het
Slc9a9 T A 9: 94,939,563 probably null Het
Syne2 T A 12: 75,986,975 M3666K probably benign Het
Synpo2 A G 3: 123,079,897 V1140A probably benign Het
Thada A G 17: 84,231,096 F1495L probably benign Het
Timeless A G 10: 128,241,425 probably null Het
Tlr6 G T 5: 64,955,205 H120N possibly damaging Het
Tmem173 A G 18: 35,735,111 probably null Het
Tns3 T C 11: 8,445,703 I1234V probably benign Het
Ttll9 A G 2: 153,000,179 S318G probably benign Het
Vps13c T C 9: 67,922,915 probably benign Het
Zfp933 T C 4: 147,826,442 I232M probably benign Het
Zfyve27 T C 19: 42,189,585 S382P probably damaging Het
Other mutations in Esf1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00925:Esf1 APN 2 140167817 missense probably benign 0.09
IGL01075:Esf1 APN 2 140120745 missense probably benign 0.01
IGL01777:Esf1 APN 2 140157172 splice site probably null
IGL01863:Esf1 APN 2 140120679 missense probably benign 0.00
IGL01982:Esf1 APN 2 140164528 missense probably benign 0.00
IGL02040:Esf1 APN 2 140129261 missense possibly damaging 0.70
IGL02063:Esf1 APN 2 140164457 missense possibly damaging 0.88
IGL03063:Esf1 APN 2 140154786 unclassified probably benign
PIT4418001:Esf1 UTSW 2 140159777 missense probably benign 0.18
R0255:Esf1 UTSW 2 140148923 unclassified probably benign
R0564:Esf1 UTSW 2 140158586 missense possibly damaging 0.86
R0655:Esf1 UTSW 2 140148879 missense probably benign 0.25
R0831:Esf1 UTSW 2 140168359 missense probably damaging 1.00
R1642:Esf1 UTSW 2 140158486 missense possibly damaging 0.85
R1984:Esf1 UTSW 2 140148886 missense possibly damaging 0.83
R3981:Esf1 UTSW 2 140158556 missense probably benign 0.40
R4736:Esf1 UTSW 2 140124971 missense probably damaging 0.98
R5083:Esf1 UTSW 2 140157071 missense possibly damaging 0.93
R5083:Esf1 UTSW 2 140158579 missense possibly damaging 0.96
R5222:Esf1 UTSW 2 140158583 missense possibly damaging 0.86
R5347:Esf1 UTSW 2 140154881 nonsense probably null
R5654:Esf1 UTSW 2 140164228 missense possibly damaging 0.85
R6123:Esf1 UTSW 2 140168389 missense probably benign 0.01
R6132:Esf1 UTSW 2 140159779 missense probably benign 0.18
R6299:Esf1 UTSW 2 140123634 missense possibly damaging 0.53
R6484:Esf1 UTSW 2 140158538 missense probably benign 0.03
R6541:Esf1 UTSW 2 140167879 missense probably benign 0.00
R6674:Esf1 UTSW 2 140120806 nonsense probably null
R7203:Esf1 UTSW 2 140164219 missense possibly damaging 0.53
R7309:Esf1 UTSW 2 140125091 intron probably null
R7379:Esf1 UTSW 2 140154934 missense probably benign 0.33
RF006:Esf1 UTSW 2 140164374 small deletion probably benign
Predicted Primers PCR Primer
(F):5'- TGAGGCGAGAGCAGTTATTTGACC -3'
(R):5'- TGCCTTGGGAACCACTTCTCTAGTC -3'

Sequencing Primer
(F):5'- AGAGCAGTTATTTGACCCTCTG -3'
(R):5'- tgcctgtaatcccagttctc -3'
Posted On2013-04-24