Incidental Mutation 'R4043:Ndnf'
ID313925
Institutional Source Beutler Lab
Gene Symbol Ndnf
Ensembl Gene ENSMUSG00000049001
Gene Nameneuron-derived neurotrophic factor
SynonymsA930038C07Rik, epidermacan
MMRRC Submission 041615-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.104) question?
Stock #R4043 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location65671590-65712326 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 65703936 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Tyrosine at position 400 (N400Y)
Ref Sequence ENSEMBL: ENSMUSP00000051297 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000054351]
Predicted Effect possibly damaging
Transcript: ENSMUST00000054351
AA Change: N400Y

PolyPhen 2 Score 0.893 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000051297
Gene: ENSMUSG00000049001
AA Change: N400Y

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Blast:FN3 71 161 2e-33 BLAST
FN3 174 324 5.75e-2 SMART
FN3 445 554 1.62e0 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000169795
Meta Mutation Damage Score 0.0974 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 92.9%
Validation Efficiency 97% (64/66)
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4430402I18Rik A T 19: 28,945,783 C80S possibly damaging Het
4930415L06Rik A G X: 89,932,303 F96S probably damaging Het
Adgrf3 T C 5: 30,204,362 N44D probably benign Het
AU018091 A G 7: 3,159,122 F375L probably damaging Het
Bsph1 G T 7: 13,458,276 probably null Het
Casp1 A G 9: 5,302,444 D122G probably benign Het
Ccdc146 C T 5: 21,316,943 C361Y probably benign Het
Cdc37l1 T C 19: 28,990,628 S31P possibly damaging Het
Cdca2 A T 14: 67,704,006 M249K probably benign Het
Cfap73 C T 5: 120,629,965 probably null Het
Cgnl1 A G 9: 71,705,293 L749S probably damaging Het
Cmtr2 C A 8: 110,221,830 C257* probably null Het
Col6a4 A T 9: 106,072,411 L675* probably null Het
Cpne8 A T 15: 90,572,001 D186E probably damaging Het
Csmd3 A G 15: 47,755,966 probably null Het
D330045A20Rik C T X: 139,507,003 S364L probably damaging Het
D430042O09Rik A G 7: 125,868,741 I1366V probably benign Het
Daglb T A 5: 143,487,151 Y354N possibly damaging Het
Dlgap1 T C 17: 70,761,080 S549P probably damaging Het
Dnah11 T C 12: 117,879,943 D4389G probably damaging Het
Dst T A 1: 34,190,684 C2631S probably benign Het
Gimap1 T A 6: 48,743,242 W263R probably damaging Het
Gne A C 4: 44,040,383 C594G possibly damaging Het
Gtf2a1 T C 12: 91,575,667 H47R probably benign Het
Hdac6 T C X: 7,931,492 T993A probably benign Het
Helz2 T C 2: 181,229,710 D2703G probably benign Het
Jmjd1c G A 10: 67,219,466 V222I possibly damaging Het
Kndc1 A G 7: 139,924,129 E1116G probably benign Het
Krt10 C T 11: 99,386,993 probably null Het
Lrrc37a T G 11: 103,498,653 H1982P possibly damaging Het
Med13l T A 5: 118,593,463 L68Q probably damaging Het
Megf10 C A 18: 57,259,798 D422E probably damaging Het
Mpz C T 1: 171,159,771 probably benign Het
Muc5ac A T 7: 141,807,478 T1508S possibly damaging Het
Myo3a C T 2: 22,333,539 probably benign Het
Olfr192 G A 16: 59,098,761 T77I unknown Het
Olfr414 T C 1: 174,431,091 I221T probably damaging Het
Olfr855 G T 9: 19,584,995 V153F probably benign Het
Otol1 A G 3: 70,027,779 D368G probably damaging Het
Pappa A G 4: 65,314,587 N1321S probably benign Het
Patl1 T A 19: 11,942,950 L756Q probably damaging Het
Plcg2 A G 8: 117,612,978 M1043V probably benign Het
Plekhg2 G A 7: 28,364,719 probably benign Het
Ppp2r2d G A 7: 138,882,416 W265* probably null Het
Prss40 G T 1: 34,560,879 S9* probably null Het
Radil T A 5: 142,494,233 I471F probably benign Het
Rpl10l A T 12: 66,284,203 M52K probably damaging Het
Scn1a A T 2: 66,326,036 S510T possibly damaging Het
Sdad1 T G 5: 92,302,694 N194T probably damaging Het
Sel1l3 A T 5: 53,188,054 Y259* probably null Het
Slc22a26 T C 19: 7,788,329 probably null Het
Snap91 C T 9: 86,777,049 G477D probably damaging Het
Srr T C 11: 74,909,121 T202A probably benign Het
Srrm1 C T 4: 135,340,931 probably benign Het
Trp53bp2 T A 1: 182,449,061 L869Q possibly damaging Het
Ttbk1 T A 17: 46,446,762 D982V probably benign Het
Ttn T C 2: 76,794,157 T15324A probably benign Het
Ush1c T C 7: 46,221,528 E276G probably damaging Het
Vcan T A 13: 89,692,543 L1627F probably benign Het
Vps8 A C 16: 21,526,396 D823A probably damaging Het
Zfp616 T A 11: 74,085,282 N792K possibly damaging Het
Zfpm2 A T 15: 40,870,627 D2V possibly damaging Het
Zfyve16 A C 13: 92,513,763 probably null Het
Zmym2 T A 14: 56,958,308 probably benign Het
Other mutations in Ndnf
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00755:Ndnf APN 6 65703258 missense probably damaging 1.00
IGL01737:Ndnf APN 6 65703555 missense probably benign 0.15
IGL03000:Ndnf APN 6 65703315 missense possibly damaging 0.95
IGL03236:Ndnf APN 6 65696172 missense possibly damaging 0.74
IGL03373:Ndnf APN 6 65704288 missense possibly damaging 0.47
K3955:Ndnf UTSW 6 65701429 splice site probably benign
R1457:Ndnf UTSW 6 65704014 missense possibly damaging 0.82
R1670:Ndnf UTSW 6 65703070 missense probably benign 0.00
R1687:Ndnf UTSW 6 65703423 missense probably benign 0.00
R1909:Ndnf UTSW 6 65703313 missense possibly damaging 0.94
R3951:Ndnf UTSW 6 65703141 missense possibly damaging 0.79
R4465:Ndnf UTSW 6 65704196 missense probably benign
R4983:Ndnf UTSW 6 65703571 missense possibly damaging 0.89
R5271:Ndnf UTSW 6 65703666 missense possibly damaging 0.52
R6785:Ndnf UTSW 6 65703063 missense probably benign 0.01
R7874:Ndnf UTSW 6 65703429 missense probably benign
R7957:Ndnf UTSW 6 65703429 missense probably benign
R8049:Ndnf UTSW 6 65703430 missense probably benign 0.04
RF017:Ndnf UTSW 6 65704329 missense probably damaging 0.97
X0066:Ndnf UTSW 6 65701517 nonsense probably null
Predicted Primers PCR Primer
(F):5'- CTTTGTCAGGACCAAGGAGGAG -3'
(R):5'- AAGAGCAGGTACGTAGCTTG -3'

Sequencing Primer
(F):5'- CAAAACAGAAGACAGTGGAACTC -3'
(R):5'- CAGGTACGTAGCTTGTCAAAAG -3'
Posted On2015-04-30