Incidental Mutation 'R0388:Kif16b'
ID 31393
Institutional Source Beutler Lab
Gene Symbol Kif16b
Ensembl Gene ENSMUSG00000038844
Gene Name kinesin family member 16B
Synonyms 8430434E15Rik, N-3 kinesin
MMRRC Submission 038594-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R0388 (G1)
Quality Score 203
Status Validated
Chromosome 2
Chromosomal Location 142617474-142901531 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 142740937 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Glycine at position 556 (E556G)
Ref Sequence ENSEMBL: ENSMUSP00000154926 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043589] [ENSMUST00000211861] [ENSMUST00000230763]
AlphaFold B1AVY7
Predicted Effect probably damaging
Transcript: ENSMUST00000043589
AA Change: E556G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000042551
Gene: ENSMUSG00000038844
AA Change: E556G

DomainStartEndE-ValueType
KISc 1 366 4.87e-173 SMART
FHA 477 529 1.43e-1 SMART
coiled coil region 597 809 N/A INTRINSIC
coiled coil region 835 858 N/A INTRINSIC
coiled coil region 941 1022 N/A INTRINSIC
PX 1179 1281 1.58e-5 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000211861
AA Change: E556G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000230763
AA Change: E556G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Meta Mutation Damage Score 0.6065 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.0%
  • 10x: 95.6%
  • 20x: 90.7%
Validation Efficiency 100% (67/67)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a kinesin-like protein that may be involved in intracellular trafficking. Three transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2010]
PHENOTYPE: Chimera embryos containing a knock-out allele and derived from tetraploid rescue exhibit lethal growth arrest at the blastocyst stage with abnormal development of the primitive endoderm, epiblast epithelium, and basement membrane. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010315B03Rik T C 9: 124,295,159 probably benign Het
Acsbg1 T C 9: 54,609,063 K678R probably damaging Het
Adgrg6 A G 10: 14,450,658 I410T probably benign Het
Afap1l2 A C 19: 56,917,242 probably benign Het
Aox2 T C 1: 58,354,406 Y1242H probably damaging Het
Apoo-ps T C 13: 107,414,673 noncoding transcript Het
Camta1 C A 4: 151,075,140 R1614L probably damaging Het
Cdh3 C A 8: 106,539,129 T268K probably damaging Het
Chd5 T A 4: 152,371,644 H923Q probably damaging Het
Chd7 T C 4: 8,854,560 V1967A probably benign Het
Cntn3 T C 6: 102,277,316 M222V probably damaging Het
Dcaf17 A G 2: 71,078,571 K277R probably benign Het
Dmbt1 T C 7: 131,096,049 probably benign Het
Dmpk T A 7: 19,084,077 probably benign Het
Dzank1 A T 2: 144,476,106 L714Q possibly damaging Het
Efcab3 A G 11: 105,109,401 D272G possibly damaging Het
Erbb2 G C 11: 98,427,351 R471P possibly damaging Het
Esf1 T A 2: 140,120,871 Y760F possibly damaging Het
Fanci C A 7: 79,439,630 T938K probably benign Het
Gnai3 A G 3: 108,115,757 probably benign Het
Hspg2 T A 4: 137,511,158 C319S probably damaging Het
Il12a T A 3: 68,695,187 probably null Het
Inpp4a A G 1: 37,396,160 D837G probably damaging Het
Kcnj5 T A 9: 32,317,863 E13V probably damaging Het
Kcnq3 T A 15: 66,000,038 Y594F probably benign Het
Kif28 T C 1: 179,740,089 I39V possibly damaging Het
Lgi2 T C 5: 52,554,549 E143G probably damaging Het
Mast1 T G 8: 84,915,537 I1063L probably benign Het
Med12l T C 3: 59,093,504 probably benign Het
Mmp19 G T 10: 128,798,883 R456L probably benign Het
Mon1b T A 8: 113,639,078 V346E probably damaging Het
Mpv17l A T 16: 13,940,999 I96L probably benign Het
Mrgpra9 A T 7: 47,252,794 M1K probably null Het
Mycbp2 A T 14: 103,156,667 H2819Q probably benign Het
Nav1 A C 1: 135,448,917 probably benign Het
Neurl4 T C 11: 69,911,733 probably benign Het
Ntng2 G C 2: 29,207,426 P341R probably damaging Het
Oas1d A T 5: 120,917,028 Y221F probably damaging Het
Olfr1040 A G 2: 86,146,630 Y35H probably damaging Het
Olfr348 C A 2: 36,786,862 D112E probably benign Het
Olfr365 A C 2: 37,202,184 probably null Het
Osbpl8 A G 10: 111,272,282 M380V probably benign Het
Pank1 T C 19: 34,821,706 probably benign Het
Parn T C 16: 13,654,476 D169G possibly damaging Het
Pknox1 T A 17: 31,603,192 I311N probably damaging Het
Pprc1 T C 19: 46,062,775 V248A possibly damaging Het
Prkcq T C 2: 11,254,234 C322R probably benign Het
Ptpn13 T A 5: 103,555,062 I1298N probably benign Het
Rab11fip3 A G 17: 26,069,072 S36P probably benign Het
Rif1 GCCACCA GCCA 2: 52,110,324 probably benign Het
Sass6 C A 3: 116,607,308 probably benign Het
Shroom3 G A 5: 92,951,293 G1463D probably benign Het
Slc35d1 A T 4: 103,184,887 Y249* probably null Het
Slc9a3 C T 13: 74,121,536 P8S unknown Het
Slc9a9 T A 9: 94,939,563 probably null Het
Syne2 T A 12: 75,986,975 M3666K probably benign Het
Synpo2 A G 3: 123,079,897 V1140A probably benign Het
Thada A G 17: 84,231,096 F1495L probably benign Het
Timeless A G 10: 128,241,425 probably null Het
Tlr6 G T 5: 64,955,205 H120N possibly damaging Het
Tmem173 A G 18: 35,735,111 probably null Het
Tns3 T C 11: 8,445,703 I1234V probably benign Het
Ttll9 A G 2: 153,000,179 S318G probably benign Het
Vps13c T C 9: 67,922,915 probably benign Het
Zfp933 T C 4: 147,826,442 I232M probably benign Het
Zfyve27 T C 19: 42,189,585 S382P probably damaging Het
Other mutations in Kif16b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00466:Kif16b APN 2 142848035 nonsense probably null
IGL00499:Kif16b APN 2 142857324 missense probably damaging 1.00
IGL00913:Kif16b APN 2 142704007 nonsense probably null
IGL00971:Kif16b APN 2 142711744 missense probably benign 0.01
IGL01712:Kif16b APN 2 142648471 missense probably damaging 1.00
IGL01965:Kif16b APN 2 142848405 missense probably damaging 1.00
IGL02428:Kif16b APN 2 142672360 missense possibly damaging 0.88
IGL02576:Kif16b APN 2 142862545 splice site probably benign
IGL02884:Kif16b APN 2 142702614 splice site probably benign
IGL03065:Kif16b APN 2 142619913 missense probably damaging 1.00
IGL03103:Kif16b APN 2 142862488 missense probably damaging 1.00
IGL03403:Kif16b APN 2 142711869 missense probably damaging 1.00
IGL02835:Kif16b UTSW 2 142712213 missense probably benign 0.00
R0058:Kif16b UTSW 2 142857305 splice site probably null
R0058:Kif16b UTSW 2 142857305 splice site probably null
R0081:Kif16b UTSW 2 142707426 splice site probably benign
R0123:Kif16b UTSW 2 142672375 missense probably benign
R0134:Kif16b UTSW 2 142672375 missense probably benign
R0396:Kif16b UTSW 2 142853659 missense probably damaging 1.00
R0502:Kif16b UTSW 2 142712155 missense probably benign 0.00
R1027:Kif16b UTSW 2 142854538 splice site probably benign
R1674:Kif16b UTSW 2 142712953 nonsense probably null
R1752:Kif16b UTSW 2 142690666 missense probably benign 0.01
R2154:Kif16b UTSW 2 142690580 missense probably damaging 1.00
R2262:Kif16b UTSW 2 142740917 missense probably damaging 1.00
R2401:Kif16b UTSW 2 142756122 missense probably benign 0.04
R3951:Kif16b UTSW 2 142707359 missense probably benign 0.01
R4161:Kif16b UTSW 2 142707404 missense probably benign 0.00
R4697:Kif16b UTSW 2 142690694 missense probably benign 0.09
R4747:Kif16b UTSW 2 142857426 missense probably damaging 1.00
R4808:Kif16b UTSW 2 142857358 missense probably damaging 1.00
R4878:Kif16b UTSW 2 142848003 missense probably damaging 1.00
R5068:Kif16b UTSW 2 142711707 missense probably benign
R5120:Kif16b UTSW 2 142848339 missense probably damaging 1.00
R5358:Kif16b UTSW 2 142740969 missense probably damaging 1.00
R5821:Kif16b UTSW 2 142702666 missense probably damaging 1.00
R5833:Kif16b UTSW 2 142707367 missense probably benign
R5882:Kif16b UTSW 2 142707258 critical splice donor site probably null
R5974:Kif16b UTSW 2 142857381 missense probably damaging 1.00
R6043:Kif16b UTSW 2 142711900 missense probably damaging 1.00
R6230:Kif16b UTSW 2 142849912 missense probably damaging 1.00
R6373:Kif16b UTSW 2 142699698 missense possibly damaging 0.91
R6472:Kif16b UTSW 2 142699948 intron probably benign
R6622:Kif16b UTSW 2 142712442 missense probably benign 0.01
R6654:Kif16b UTSW 2 142701277 intron probably benign
R6912:Kif16b UTSW 2 142700099 intron probably benign
R7003:Kif16b UTSW 2 142758829 missense possibly damaging 0.95
R7265:Kif16b UTSW 2 142714730 missense probably damaging 1.00
R7307:Kif16b UTSW 2 142712931 missense probably benign 0.00
R7376:Kif16b UTSW 2 142711872 missense probably damaging 0.99
R7381:Kif16b UTSW 2 142857423 missense probably damaging 1.00
R7558:Kif16b UTSW 2 142758826 missense probably damaging 1.00
R7681:Kif16b UTSW 2 142756126 missense probably damaging 1.00
R7896:Kif16b UTSW 2 142834075 critical splice donor site probably null
R7956:Kif16b UTSW 2 142862470 missense probably benign 0.00
R8053:Kif16b UTSW 2 142853714 missense probably damaging 1.00
R8056:Kif16b UTSW 2 142712842 missense probably damaging 1.00
R8139:Kif16b UTSW 2 142901365 missense probably benign 0.00
R8182:Kif16b UTSW 2 142712899 missense possibly damaging 0.90
R8224:Kif16b UTSW 2 142834088 missense probably benign 0.03
R8357:Kif16b UTSW 2 142711908 missense probably damaging 1.00
R8359:Kif16b UTSW 2 142711857 missense probably benign 0.05
R8360:Kif16b UTSW 2 142711857 missense probably benign 0.05
R8369:Kif16b UTSW 2 142711857 missense probably benign 0.05
R8385:Kif16b UTSW 2 142712338 missense probably benign 0.09
R8457:Kif16b UTSW 2 142711908 missense probably damaging 1.00
R8720:Kif16b UTSW 2 142849872 missense probably damaging 1.00
R8898:Kif16b UTSW 2 142712979 missense possibly damaging 0.81
R8987:Kif16b UTSW 2 142849863 critical splice donor site probably null
R8987:Kif16b UTSW 2 142901358 missense probably benign 0.00
R9022:Kif16b UTSW 2 142712617 missense possibly damaging 0.46
R9040:Kif16b UTSW 2 142849878 missense probably benign 0.02
R9044:Kif16b UTSW 2 142699657 missense possibly damaging 0.91
R9138:Kif16b UTSW 2 142700556 missense
R9167:Kif16b UTSW 2 142700920 nonsense probably null
R9218:Kif16b UTSW 2 142699663 missense possibly damaging 0.77
R9283:Kif16b UTSW 2 142712980 missense probably benign 0.00
R9300:Kif16b UTSW 2 142699287 missense probably benign
R9378:Kif16b UTSW 2 142619818 nonsense probably null
R9522:Kif16b UTSW 2 142849907 missense probably damaging 0.96
R9588:Kif16b UTSW 2 142711884 missense possibly damaging 0.82
R9632:Kif16b UTSW 2 142712040 missense probably benign 0.00
R9641:Kif16b UTSW 2 142700669 missense probably benign 0.01
X0058:Kif16b UTSW 2 142758861 missense probably damaging 1.00
Z1177:Kif16b UTSW 2 142711824 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- TGCTCACTTAATGCCATGCCACAC -3'
(R):5'- GCCTTTGAGACTGAAGCCTCTCATC -3'

Sequencing Primer
(F):5'- ACAAAGCCTGGCTCCTCTG -3'
(R):5'- GAAGCCTCTCATCCTTTTCTAACG -3'
Posted On 2013-04-24