Mutagenetix > Incidental Mutations

Incidental Mutation 'R4043:Casp1'

313937

Institutional Source

Beutler Lab

Gene Symbol

Casp1

Ensembl Gene

ENSMUSG00000025888

Gene Name

caspase 1

Synonyms

ICE, Il1bc, Caspase-1, interleukin 1 beta-converting enzyme

MMRRC Submission

041615-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R4043 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

5298517-5307265 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 5302444 bp

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glycine at position 122 (D122G)

Ref Sequence

ENSEMBL: ENSMUSP00000027015 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000027015]

Predicted Effect

probably benign
Transcript: ENSMUST00000027015
AA Change: D122G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000027015
Gene: ENSMUSG00000025888
AA Change: D122G

Domain	Start	End	E-Value	Type
CARD	4	89	4.91e-19	SMART
CASc	151	400	1.82e-136	SMART

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.1%
3x: 98.4%
10x: 96.7%
20x: 92.9%

Validation Efficiency

97% (64/66)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein which is a member of the cysteine-aspartic acid protease (caspase) family. Sequential activation of caspases plays a central role in the execution-phase of cell apoptosis. Caspases exist as inactive proenzymes which undergo proteolytic processing at conserved aspartic residues to produce 2 subunits, large and small, that dimerize to form the active enzyme. This gene was identified by its ability to proteolytically cleave and activate the inactive precursor of interleukin-1, a cytokine involved in the processes such as inflammation, septic shock, and wound healing. This gene has been shown to induce cell apoptosis and may function in various developmental stages. Studies of a similar gene in mouse suggest a role in the pathogenesis of Huntington disease. Alternative splicing results in transcript variants encoding distinct isoforms. [provided by RefSeq, Mar 2012]
PHENOTYPE: Homozygous targeted mutants fail to produce mature IL1A and IL1B and are resistant to LPS-induced endotoxin shock and to FAS antibody-induced apoptosis. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 64 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4430402I18Rik	A	T	19: 28,945,783	C80S	possibly damaging	Het
4930415L06Rik	A	G	X: 89,932,303	F96S	probably damaging	Het
Adgrf3	T	C	5: 30,204,362	N44D	probably benign	Het
AU018091	A	G	7: 3,159,122	F375L	probably damaging	Het
Bsph1	G	T	7: 13,458,276		probably null	Het
Ccdc146	C	T	5: 21,316,943	C361Y	probably benign	Het
Cdc37l1	T	C	19: 28,990,628	S31P	possibly damaging	Het
Cdca2	A	T	14: 67,704,006	M249K	probably benign	Het
Cfap73	C	T	5: 120,629,965		probably null	Het
Cgnl1	A	G	9: 71,705,293	L749S	probably damaging	Het
Cmtr2	C	A	8: 110,221,830	C257*	probably null	Het
Col6a4	A	T	9: 106,072,411	L675*	probably null	Het
Cpne8	A	T	15: 90,572,001	D186E	probably damaging	Het
Csmd3	A	G	15: 47,755,966		probably null	Het
D330045A20Rik	C	T	X: 139,507,003	S364L	probably damaging	Het
D430042O09Rik	A	G	7: 125,868,741	I1366V	probably benign	Het
Daglb	T	A	5: 143,487,151	Y354N	possibly damaging	Het
Dlgap1	T	C	17: 70,761,080	S549P	probably damaging	Het
Dnah11	T	C	12: 117,879,943	D4389G	probably damaging	Het
Dst	T	A	1: 34,190,684	C2631S	probably benign	Het
Gimap1	T	A	6: 48,743,242	W263R	probably damaging	Het
Gne	A	C	4: 44,040,383	C594G	possibly damaging	Het
Gtf2a1	T	C	12: 91,575,667	H47R	probably benign	Het
Hdac6	T	C	X: 7,931,492	T993A	probably benign	Het
Helz2	T	C	2: 181,229,710	D2703G	probably benign	Het
Jmjd1c	G	A	10: 67,219,466	V222I	possibly damaging	Het
Kndc1	A	G	7: 139,924,129	E1116G	probably benign	Het
Krt10	C	T	11: 99,386,993		probably null	Het
Lrrc37a	T	G	11: 103,498,653	H1982P	possibly damaging	Het
Med13l	T	A	5: 118,593,463	L68Q	probably damaging	Het
Megf10	C	A	18: 57,259,798	D422E	probably damaging	Het
Mpz	C	T	1: 171,159,771		probably benign	Het
Muc5ac	A	T	7: 141,807,478	T1508S	possibly damaging	Het
Myo3a	C	T	2: 22,333,539		probably benign	Het
Ndnf	A	T	6: 65,703,936	N400Y	possibly damaging	Het
Olfr192	G	A	16: 59,098,761	T77I	unknown	Het
Olfr414	T	C	1: 174,431,091	I221T	probably damaging	Het
Olfr855	G	T	9: 19,584,995	V153F	probably benign	Het
Otol1	A	G	3: 70,027,779	D368G	probably damaging	Het
Pappa	A	G	4: 65,314,587	N1321S	probably benign	Het
Patl1	T	A	19: 11,942,950	L756Q	probably damaging	Het
Plcg2	A	G	8: 117,612,978	M1043V	probably benign	Het
Plekhg2	G	A	7: 28,364,719		probably benign	Het
Ppp2r2d	G	A	7: 138,882,416	W265*	probably null	Het
Prss40	G	T	1: 34,560,879	S9*	probably null	Het
Radil	T	A	5: 142,494,233	I471F	probably benign	Het
Rpl10l	A	T	12: 66,284,203	M52K	probably damaging	Het
Scn1a	A	T	2: 66,326,036	S510T	possibly damaging	Het
Sdad1	T	G	5: 92,302,694	N194T	probably damaging	Het
Sel1l3	A	T	5: 53,188,054	Y259*	probably null	Het
Slc22a26	T	C	19: 7,788,329		probably null	Het
Snap91	C	T	9: 86,777,049	G477D	probably damaging	Het
Srr	T	C	11: 74,909,121	T202A	probably benign	Het
Srrm1	C	T	4: 135,340,931		probably benign	Het
Trp53bp2	T	A	1: 182,449,061	L869Q	possibly damaging	Het
Ttbk1	T	A	17: 46,446,762	D982V	probably benign	Het
Ttn	T	C	2: 76,794,157	T15324A	probably benign	Het
Ush1c	T	C	7: 46,221,528	E276G	probably damaging	Het
Vcan	T	A	13: 89,692,543	L1627F	probably benign	Het
Vps8	A	C	16: 21,526,396	D823A	probably damaging	Het
Zfp616	T	A	11: 74,085,282	N792K	possibly damaging	Het
Zfpm2	A	T	15: 40,870,627	D2V	possibly damaging	Het
Zfyve16	A	C	13: 92,513,763		probably null	Het
Zmym2	T	A	14: 56,958,308		probably benign	Het

Other mutations in Casp1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00235:Casp1	APN	9	5299872	splice site	probably benign
IGL00667:Casp1	APN	9	5303756	missense	probably benign	0.40
IGL01998:Casp1	APN	9	5303043	missense	probably damaging	1.00
IGL02248:Casp1	APN	9	5299452	missense	probably benign	0.01
IGL02469:Casp1	APN	9	5303105	missense	probably benign	0.19
P0027:Casp1	UTSW	9	5299851	missense	probably benign	0.00
PIT4305001:Casp1	UTSW	9	5306135	missense	probably benign	0.03
R0724:Casp1	UTSW	9	5303077	missense	probably benign
R1169:Casp1	UTSW	9	5299454	missense	possibly damaging	0.93
R1876:Casp1	UTSW	9	5303663	missense	probably benign	0.01
R2316:Casp1	UTSW	9	5306213	missense	possibly damaging	0.92
R2877:Casp1	UTSW	9	5303110	missense	probably damaging	1.00
R2885:Casp1	UTSW	9	5299851	missense	probably benign	0.00
R4367:Casp1	UTSW	9	5299333	missense	probably benign	0.41
R4656:Casp1	UTSW	9	5304324	missense	probably damaging	1.00
R4705:Casp1	UTSW	9	5306204	missense	probably damaging	1.00
R4790:Casp1	UTSW	9	5303020	missense	probably benign	0.01
R4858:Casp1	UTSW	9	5306742	missense	probably damaging	1.00
R5607:Casp1	UTSW	9	5303143	missense	probably damaging	1.00
R5784:Casp1	UTSW	9	5299337	missense	probably damaging	0.98
R6578:Casp1	UTSW	9	5304280	missense	probably benign	0.04
R7111:Casp1	UTSW	9	5299816	missense	probably benign	0.01
R7215:Casp1	UTSW	9	5298523	utr 5 prime	probably null
R7590:Casp1	UTSW	9	5306710	missense	probably damaging	1.00
R8002:Casp1	UTSW	9	5303164	missense	possibly damaging	0.94
T0722:Casp1	UTSW	9	5299851	missense	probably benign	0.00
X0003:Casp1	UTSW	9	5299851	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- ATCCTCCATCACATCATTAGGG -3'
(R):5'- TTGCAACGAACTTGGCTATGAC -3'

Sequencing Primer
(F):5'- ACATCATTAGGGATCTCTCTGACTTG -3'
(R):5'- GAACTTGGCTATGACACAGAAC -3'

Posted On

2015-04-30