Incidental Mutation 'R4043:Zfp616'
ID313944
Institutional Source Beutler Lab
Gene Symbol Zfp616
Ensembl Gene ENSMUSG00000069476
Gene Namezinc finger protein 616
SynonymsGm12330
MMRRC Submission 041615-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4043 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location74069955-74087292 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 74085282 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 792 (N792K)
Ref Sequence ENSEMBL: ENSMUSP00000136549 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074813] [ENSMUST00000108463] [ENSMUST00000116546] [ENSMUST00000178159]
Predicted Effect probably benign
Transcript: ENSMUST00000074813
SMART Domains Protein: ENSMUSP00000074365
Gene: ENSMUSG00000069476

DomainStartEndE-ValueType
KRAB 8 68 1.79e-34 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000108463
SMART Domains Protein: ENSMUSP00000104103
Gene: ENSMUSG00000069476

DomainStartEndE-ValueType
KRAB 8 68 1.79e-34 SMART
low complexity region 249 258 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000116546
SMART Domains Protein: ENSMUSP00000112245
Gene: ENSMUSG00000069476

DomainStartEndE-ValueType
KRAB 8 68 1.79e-34 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137407
Predicted Effect possibly damaging
Transcript: ENSMUST00000178159
AA Change: N792K

PolyPhen 2 Score 0.495 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000136549
Gene: ENSMUSG00000069476
AA Change: N792K

DomainStartEndE-ValueType
internal_repeat_1 125 447 7.61e-6 PROSPERO
ZnF_C2H2 452 474 3.11e-2 SMART
ZnF_C2H2 509 531 2.61e-4 SMART
ZnF_C2H2 537 559 1.47e-3 SMART
ZnF_C2H2 565 587 5.21e-4 SMART
ZnF_C2H2 593 615 1.22e-4 SMART
ZnF_C2H2 621 643 2.57e-3 SMART
ZnF_C2H2 649 671 9.22e-5 SMART
ZnF_C2H2 677 699 5.9e-3 SMART
ZnF_C2H2 705 727 4.94e-5 SMART
ZnF_C2H2 733 755 8.34e-3 SMART
ZnF_C2H2 761 783 1.6e-4 SMART
ZnF_C2H2 789 811 6.88e-4 SMART
ZnF_C2H2 817 839 1.6e-4 SMART
ZnF_C2H2 845 867 1.3e-4 SMART
ZnF_C2H2 873 895 7.37e-4 SMART
ZnF_C2H2 901 923 1.6e-4 SMART
ZnF_C2H2 929 951 1.3e-4 SMART
ZnF_C2H2 957 979 3.95e-4 SMART
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 92.9%
Validation Efficiency 97% (64/66)
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4430402I18Rik A T 19: 28,945,783 C80S possibly damaging Het
4930415L06Rik A G X: 89,932,303 F96S probably damaging Het
Adgrf3 T C 5: 30,204,362 N44D probably benign Het
AU018091 A G 7: 3,159,122 F375L probably damaging Het
Bsph1 G T 7: 13,458,276 probably null Het
Casp1 A G 9: 5,302,444 D122G probably benign Het
Ccdc146 C T 5: 21,316,943 C361Y probably benign Het
Cdc37l1 T C 19: 28,990,628 S31P possibly damaging Het
Cdca2 A T 14: 67,704,006 M249K probably benign Het
Cfap73 C T 5: 120,629,965 probably null Het
Cgnl1 A G 9: 71,705,293 L749S probably damaging Het
Cmtr2 C A 8: 110,221,830 C257* probably null Het
Col6a4 A T 9: 106,072,411 L675* probably null Het
Cpne8 A T 15: 90,572,001 D186E probably damaging Het
Csmd3 A G 15: 47,755,966 probably null Het
D330045A20Rik C T X: 139,507,003 S364L probably damaging Het
D430042O09Rik A G 7: 125,868,741 I1366V probably benign Het
Daglb T A 5: 143,487,151 Y354N possibly damaging Het
Dlgap1 T C 17: 70,761,080 S549P probably damaging Het
Dnah11 T C 12: 117,879,943 D4389G probably damaging Het
Dst T A 1: 34,190,684 C2631S probably benign Het
Gimap1 T A 6: 48,743,242 W263R probably damaging Het
Gne A C 4: 44,040,383 C594G possibly damaging Het
Gtf2a1 T C 12: 91,575,667 H47R probably benign Het
Hdac6 T C X: 7,931,492 T993A probably benign Het
Helz2 T C 2: 181,229,710 D2703G probably benign Het
Jmjd1c G A 10: 67,219,466 V222I possibly damaging Het
Kndc1 A G 7: 139,924,129 E1116G probably benign Het
Krt10 C T 11: 99,386,993 probably null Het
Lrrc37a T G 11: 103,498,653 H1982P possibly damaging Het
Med13l T A 5: 118,593,463 L68Q probably damaging Het
Megf10 C A 18: 57,259,798 D422E probably damaging Het
Mpz C T 1: 171,159,771 probably benign Het
Muc5ac A T 7: 141,807,478 T1508S possibly damaging Het
Myo3a C T 2: 22,333,539 probably benign Het
Ndnf A T 6: 65,703,936 N400Y possibly damaging Het
Olfr192 G A 16: 59,098,761 T77I unknown Het
Olfr414 T C 1: 174,431,091 I221T probably damaging Het
Olfr855 G T 9: 19,584,995 V153F probably benign Het
Otol1 A G 3: 70,027,779 D368G probably damaging Het
Pappa A G 4: 65,314,587 N1321S probably benign Het
Patl1 T A 19: 11,942,950 L756Q probably damaging Het
Plcg2 A G 8: 117,612,978 M1043V probably benign Het
Plekhg2 G A 7: 28,364,719 probably benign Het
Ppp2r2d G A 7: 138,882,416 W265* probably null Het
Prss40 G T 1: 34,560,879 S9* probably null Het
Radil T A 5: 142,494,233 I471F probably benign Het
Rpl10l A T 12: 66,284,203 M52K probably damaging Het
Scn1a A T 2: 66,326,036 S510T possibly damaging Het
Sdad1 T G 5: 92,302,694 N194T probably damaging Het
Sel1l3 A T 5: 53,188,054 Y259* probably null Het
Slc22a26 T C 19: 7,788,329 probably null Het
Snap91 C T 9: 86,777,049 G477D probably damaging Het
Srr T C 11: 74,909,121 T202A probably benign Het
Srrm1 C T 4: 135,340,931 probably benign Het
Trp53bp2 T A 1: 182,449,061 L869Q possibly damaging Het
Ttbk1 T A 17: 46,446,762 D982V probably benign Het
Ttn T C 2: 76,794,157 T15324A probably benign Het
Ush1c T C 7: 46,221,528 E276G probably damaging Het
Vcan T A 13: 89,692,543 L1627F probably benign Het
Vps8 A C 16: 21,526,396 D823A probably damaging Het
Zfpm2 A T 15: 40,870,627 D2V possibly damaging Het
Zfyve16 A C 13: 92,513,763 probably null Het
Zmym2 T A 14: 56,958,308 probably benign Het
Other mutations in Zfp616
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00530:Zfp616 APN 11 74083613 missense probably damaging 0.98
IGL00570:Zfp616 APN 11 74085805 missense probably benign 0.03
IGL00594:Zfp616 APN 11 74082963 missense possibly damaging 0.72
IGL01861:Zfp616 APN 11 74082916 missense possibly damaging 0.53
IGL03022:Zfp616 APN 11 74082974 missense possibly damaging 0.85
R0197:Zfp616 UTSW 11 74085674 missense probably damaging 1.00
R0442:Zfp616 UTSW 11 74084495 missense possibly damaging 0.92
R0497:Zfp616 UTSW 11 74083480 missense probably benign 0.00
R0651:Zfp616 UTSW 11 74083729 nonsense probably null
R0730:Zfp616 UTSW 11 74084822 missense probably damaging 1.00
R0883:Zfp616 UTSW 11 74085674 missense probably damaging 1.00
R0926:Zfp616 UTSW 11 74085818 missense probably benign 0.04
R0940:Zfp616 UTSW 11 74085024 missense probably damaging 1.00
R1068:Zfp616 UTSW 11 74082941 makesense probably null
R1272:Zfp616 UTSW 11 74085236 missense probably benign 0.08
R1446:Zfp616 UTSW 11 74083238 unclassified probably null
R1482:Zfp616 UTSW 11 74083977 missense possibly damaging 0.72
R1553:Zfp616 UTSW 11 74083918 missense possibly damaging 0.53
R1564:Zfp616 UTSW 11 74084722 missense probably damaging 1.00
R1728:Zfp616 UTSW 11 74085771 missense probably damaging 0.99
R1796:Zfp616 UTSW 11 74085845 missense probably damaging 0.98
R1797:Zfp616 UTSW 11 74085279 nonsense probably null
R1993:Zfp616 UTSW 11 74084969 missense probably benign 0.08
R2026:Zfp616 UTSW 11 74083587 missense possibly damaging 0.86
R2124:Zfp616 UTSW 11 74083043 unclassified probably null
R2126:Zfp616 UTSW 11 74085403 missense probably benign 0.08
R2199:Zfp616 UTSW 11 74084630 missense possibly damaging 0.58
R2265:Zfp616 UTSW 11 74085463 missense possibly damaging 0.89
R2404:Zfp616 UTSW 11 74084856 missense probably damaging 1.00
R2508:Zfp616 UTSW 11 74083295 missense probably benign 0.01
R2519:Zfp616 UTSW 11 74084268 nonsense probably null
R3103:Zfp616 UTSW 11 74071735 missense probably benign 0.01
R3611:Zfp616 UTSW 11 74083442 missense possibly damaging 0.53
R3703:Zfp616 UTSW 11 74083319 nonsense probably null
R3744:Zfp616 UTSW 11 74083987 missense probably benign 0.01
R4273:Zfp616 UTSW 11 74083700 missense probably benign 0.00
R4384:Zfp616 UTSW 11 74083179 missense possibly damaging 0.94
R4469:Zfp616 UTSW 11 74071124 missense probably damaging 0.98
R4560:Zfp616 UTSW 11 74083034 missense probably benign 0.00
R4821:Zfp616 UTSW 11 74084207 missense probably benign 0.41
R4844:Zfp616 UTSW 11 74084399 missense probably benign 0.10
R4948:Zfp616 UTSW 11 74084004 missense possibly damaging 0.72
R5007:Zfp616 UTSW 11 74083817 missense possibly damaging 0.96
R5198:Zfp616 UTSW 11 74083510 missense probably benign 0.33
R5344:Zfp616 UTSW 11 74084495 missense possibly damaging 0.92
R5918:Zfp616 UTSW 11 74083260 missense possibly damaging 0.70
R5933:Zfp616 UTSW 11 74083126 missense probably damaging 0.96
R6084:Zfp616 UTSW 11 74083846 nonsense probably null
R6421:Zfp616 UTSW 11 74083870 missense possibly damaging 0.53
R6494:Zfp616 UTSW 11 74085192 missense probably damaging 1.00
R6523:Zfp616 UTSW 11 74083142 missense possibly damaging 0.79
R6849:Zfp616 UTSW 11 74085450 missense possibly damaging 0.70
R6910:Zfp616 UTSW 11 74085002 missense probably damaging 1.00
R7146:Zfp616 UTSW 11 74085261 missense possibly damaging 0.61
R7213:Zfp616 UTSW 11 74085863 missense probably benign 0.05
R7302:Zfp616 UTSW 11 74085379 missense probably benign 0.08
R7391:Zfp616 UTSW 11 74085329 missense probably benign 0.08
R7654:Zfp616 UTSW 11 74083187 missense possibly damaging 0.53
R7877:Zfp616 UTSW 11 74084362 missense probably damaging 1.00
R7889:Zfp616 UTSW 11 74085445 missense probably damaging 1.00
R7960:Zfp616 UTSW 11 74084362 missense probably damaging 1.00
R7972:Zfp616 UTSW 11 74085445 missense probably damaging 1.00
R8022:Zfp616 UTSW 11 74084068 missense probably benign
R8061:Zfp616 UTSW 11 74083514 missense possibly damaging 0.96
Z1176:Zfp616 UTSW 11 74083033 missense probably benign
Z1176:Zfp616 UTSW 11 74083219 missense possibly damaging 0.72
Z1176:Zfp616 UTSW 11 74085641 missense possibly damaging 0.90
Z1177:Zfp616 UTSW 11 74085052 missense possibly damaging 0.88
Predicted Primers PCR Primer
(F):5'- CAAGTCTTAAAGGTCACCACAGAAT -3'
(R):5'- CTTTAAGACTTGAGGAACGGGCA -3'

Sequencing Primer
(F):5'- CTGTGGGAAAAGTTTTAGACAGTCC -3'
(R):5'- CTTGAGGAACGGGCAAAATATTTACC -3'
Posted On2015-04-30