Incidental Mutation 'R4043:Srr'
ID313945
Institutional Source Beutler Lab
Gene Symbol Srr
Ensembl Gene ENSMUSG00000001323
Gene Nameserine racemase
Synonyms
MMRRC Submission 041615-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.356) question?
Stock #R4043 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location74906359-74925948 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 74909121 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 202 (T202A)
Ref Sequence ENSEMBL: ENSMUSP00000104086 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045807] [ENSMUST00000065211] [ENSMUST00000108447] [ENSMUST00000108448] [ENSMUST00000121738] [ENSMUST00000123855] [ENSMUST00000128230] [ENSMUST00000128556] [ENSMUST00000138612] [ENSMUST00000153316] [ENSMUST00000155702]
Predicted Effect probably benign
Transcript: ENSMUST00000045807
SMART Domains Protein: ENSMUSP00000039027
Gene: ENSMUSG00000038335

DomainStartEndE-ValueType
low complexity region 16 25 N/A INTRINSIC
AARP2CN 228 309 1.14e-28 SMART
low complexity region 373 383 N/A INTRINSIC
low complexity region 407 421 N/A INTRINSIC
low complexity region 429 452 N/A INTRINSIC
coiled coil region 453 478 N/A INTRINSIC
DUF663 486 772 2.6e-179 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000065211
AA Change: T227A

PolyPhen 2 Score 0.010 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000067552
Gene: ENSMUSG00000001323
AA Change: T227A

DomainStartEndE-ValueType
Pfam:PALP 19 314 3.3e-75 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000104305
Predicted Effect noncoding transcript
Transcript: ENSMUST00000104449
Predicted Effect probably benign
Transcript: ENSMUST00000108447
AA Change: T202A

PolyPhen 2 Score 0.082 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000104086
Gene: ENSMUSG00000001323
AA Change: T202A

DomainStartEndE-ValueType
Pfam:PALP 19 179 1.8e-41 PFAM
Pfam:PALP 173 289 4.2e-19 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000108448
AA Change: T227A

PolyPhen 2 Score 0.010 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000104087
Gene: ENSMUSG00000001323
AA Change: T227A

DomainStartEndE-ValueType
Pfam:PALP 19 314 2.1e-75 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000121738
AA Change: T227A

PolyPhen 2 Score 0.010 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000113372
Gene: ENSMUSG00000001323
AA Change: T227A

DomainStartEndE-ValueType
Pfam:PALP 19 314 3.3e-75 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000123855
SMART Domains Protein: ENSMUSP00000118485
Gene: ENSMUSG00000001323

DomainStartEndE-ValueType
Pfam:PALP 19 166 1.5e-39 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127499
Predicted Effect probably benign
Transcript: ENSMUST00000128230
SMART Domains Protein: ENSMUSP00000121384
Gene: ENSMUSG00000038335

DomainStartEndE-ValueType
low complexity region 16 25 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000128556
SMART Domains Protein: ENSMUSP00000120012
Gene: ENSMUSG00000001323

DomainStartEndE-ValueType
Pfam:PALP 19 182 2.6e-44 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130910
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135587
Predicted Effect probably benign
Transcript: ENSMUST00000138612
SMART Domains Protein: ENSMUSP00000119256
Gene: ENSMUSG00000001323

DomainStartEndE-ValueType
Pfam:PALP 19 112 4.1e-28 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147817
Predicted Effect probably benign
Transcript: ENSMUST00000153316
Predicted Effect probably benign
Transcript: ENSMUST00000155702
SMART Domains Protein: ENSMUSP00000119868
Gene: ENSMUSG00000038335

DomainStartEndE-ValueType
low complexity region 16 25 N/A INTRINSIC
low complexity region 39 58 N/A INTRINSIC
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 92.9%
Validation Efficiency 97% (64/66)
MGI Phenotype PHENOTYPE: Mice homozygous for a null allele exhibit decreased D-serine levels in the cerebral cortex and hippocampus, and neuronal damage associated with NMDA excitotoxicity and beta-amyloid peptide 1-42 exposure is decreased. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4430402I18Rik A T 19: 28,945,783 C80S possibly damaging Het
4930415L06Rik A G X: 89,932,303 F96S probably damaging Het
Adgrf3 T C 5: 30,204,362 N44D probably benign Het
AU018091 A G 7: 3,159,122 F375L probably damaging Het
Bsph1 G T 7: 13,458,276 probably null Het
Casp1 A G 9: 5,302,444 D122G probably benign Het
Ccdc146 C T 5: 21,316,943 C361Y probably benign Het
Cdc37l1 T C 19: 28,990,628 S31P possibly damaging Het
Cdca2 A T 14: 67,704,006 M249K probably benign Het
Cfap73 C T 5: 120,629,965 probably null Het
Cgnl1 A G 9: 71,705,293 L749S probably damaging Het
Cmtr2 C A 8: 110,221,830 C257* probably null Het
Col6a4 A T 9: 106,072,411 L675* probably null Het
Cpne8 A T 15: 90,572,001 D186E probably damaging Het
Csmd3 A G 15: 47,755,966 probably null Het
D330045A20Rik C T X: 139,507,003 S364L probably damaging Het
D430042O09Rik A G 7: 125,868,741 I1366V probably benign Het
Daglb T A 5: 143,487,151 Y354N possibly damaging Het
Dlgap1 T C 17: 70,761,080 S549P probably damaging Het
Dnah11 T C 12: 117,879,943 D4389G probably damaging Het
Dst T A 1: 34,190,684 C2631S probably benign Het
Gimap1 T A 6: 48,743,242 W263R probably damaging Het
Gne A C 4: 44,040,383 C594G possibly damaging Het
Gtf2a1 T C 12: 91,575,667 H47R probably benign Het
Hdac6 T C X: 7,931,492 T993A probably benign Het
Helz2 T C 2: 181,229,710 D2703G probably benign Het
Jmjd1c G A 10: 67,219,466 V222I possibly damaging Het
Kndc1 A G 7: 139,924,129 E1116G probably benign Het
Krt10 C T 11: 99,386,993 probably null Het
Lrrc37a T G 11: 103,498,653 H1982P possibly damaging Het
Med13l T A 5: 118,593,463 L68Q probably damaging Het
Megf10 C A 18: 57,259,798 D422E probably damaging Het
Mpz C T 1: 171,159,771 probably benign Het
Muc5ac A T 7: 141,807,478 T1508S possibly damaging Het
Myo3a C T 2: 22,333,539 probably benign Het
Ndnf A T 6: 65,703,936 N400Y possibly damaging Het
Olfr192 G A 16: 59,098,761 T77I unknown Het
Olfr414 T C 1: 174,431,091 I221T probably damaging Het
Olfr855 G T 9: 19,584,995 V153F probably benign Het
Otol1 A G 3: 70,027,779 D368G probably damaging Het
Pappa A G 4: 65,314,587 N1321S probably benign Het
Patl1 T A 19: 11,942,950 L756Q probably damaging Het
Plcg2 A G 8: 117,612,978 M1043V probably benign Het
Plekhg2 G A 7: 28,364,719 probably benign Het
Ppp2r2d G A 7: 138,882,416 W265* probably null Het
Prss40 G T 1: 34,560,879 S9* probably null Het
Radil T A 5: 142,494,233 I471F probably benign Het
Rpl10l A T 12: 66,284,203 M52K probably damaging Het
Scn1a A T 2: 66,326,036 S510T possibly damaging Het
Sdad1 T G 5: 92,302,694 N194T probably damaging Het
Sel1l3 A T 5: 53,188,054 Y259* probably null Het
Slc22a26 T C 19: 7,788,329 probably null Het
Snap91 C T 9: 86,777,049 G477D probably damaging Het
Srrm1 C T 4: 135,340,931 probably benign Het
Trp53bp2 T A 1: 182,449,061 L869Q possibly damaging Het
Ttbk1 T A 17: 46,446,762 D982V probably benign Het
Ttn T C 2: 76,794,157 T15324A probably benign Het
Ush1c T C 7: 46,221,528 E276G probably damaging Het
Vcan T A 13: 89,692,543 L1627F probably benign Het
Vps8 A C 16: 21,526,396 D823A probably damaging Het
Zfp616 T A 11: 74,085,282 N792K possibly damaging Het
Zfpm2 A T 15: 40,870,627 D2V possibly damaging Het
Zfyve16 A C 13: 92,513,763 probably null Het
Zmym2 T A 14: 56,958,308 probably benign Het
Other mutations in Srr
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02949:Srr APN 11 74908737 missense probably benign 0.00
IGL03268:Srr APN 11 74913117 missense probably benign 0.06
PIT4382001:Srr UTSW 11 74910308 missense probably benign 0.42
R0718:Srr UTSW 11 74911065 missense possibly damaging 0.74
R1588:Srr UTSW 11 74908803 missense possibly damaging 0.93
R1960:Srr UTSW 11 74908716 missense probably damaging 1.00
R1986:Srr UTSW 11 74908719 missense probably damaging 1.00
R4112:Srr UTSW 11 74913072 missense probably benign
R4877:Srr UTSW 11 74907780 unclassified probably benign
R5856:Srr UTSW 11 74913012 missense possibly damaging 0.92
R5959:Srr UTSW 11 74911065 missense possibly damaging 0.74
R6362:Srr UTSW 11 74910202 missense probably damaging 1.00
R7163:Srr UTSW 11 74913002 missense probably damaging 0.96
R7706:Srr UTSW 11 74913135 critical splice acceptor site probably null
R7817:Srr UTSW 11 74908698 missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- GCCGGAGTCTAGTAGGTTACATTC -3'
(R):5'- TCTGATCACCAAGGGTAACAC -3'

Sequencing Primer
(F):5'- TTCGAAAAATGAAGTAGACATTTGGG -3'
(R):5'- AGGGTAACACATCTTTAACTCTCTGC -3'
Posted On2015-04-30