Incidental Mutation 'R4043:Cdca2'
ID313954
Institutional Source Beutler Lab
Gene Symbol Cdca2
Ensembl Gene ENSMUSG00000048922
Gene Namecell division cycle associated 2
Synonyms2610311M19Rik
MMRRC Submission 041615-MU
Accession Numbers

Genbank: NM_001110162, NM_175384

Is this an essential gene? Probably non essential (E-score: 0.100) question?
Stock #R4043 (G1)
Quality Score225
Status Validated
Chromosome14
Chromosomal Location67676331-67715841 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 67704006 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 249 (M249K)
Ref Sequence ENSEMBL: ENSMUSP00000116384 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000124045] [ENSMUST00000132705] [ENSMUST00000150006] [ENSMUST00000163100]
Predicted Effect probably benign
Transcript: ENSMUST00000124045
AA Change: M249K

PolyPhen 2 Score 0.110 (Sensitivity: 0.93; Specificity: 0.86)
Predicted Effect probably benign
Transcript: ENSMUST00000132705
AA Change: M249K

PolyPhen 2 Score 0.067 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000115633
Gene: ENSMUSG00000048922
AA Change: M249K

DomainStartEndE-ValueType
Pfam:PP1_bind 378 437 4.3e-28 PFAM
low complexity region 515 528 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000150006
AA Change: M249K

PolyPhen 2 Score 0.067 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000117847
Gene: ENSMUSG00000048922
AA Change: M249K

DomainStartEndE-ValueType
Pfam:PP1_bind 378 437 5.4e-28 PFAM
low complexity region 515 528 N/A INTRINSIC
low complexity region 542 556 N/A INTRINSIC
low complexity region 931 942 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155312
Predicted Effect probably benign
Transcript: ENSMUST00000163100
AA Change: M249K

PolyPhen 2 Score 0.067 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000127571
Gene: ENSMUSG00000048922
AA Change: M249K

DomainStartEndE-ValueType
Pfam:PP1_bind 379 436 4.1e-27 PFAM
low complexity region 515 528 N/A INTRINSIC
low complexity region 542 556 N/A INTRINSIC
low complexity region 931 942 N/A INTRINSIC
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 92.9%
Validation Efficiency 97% (64/66)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a targeting subunit of the cell-cycle associated protein, protein phosphatase 1, with a role in targeting this protein to chromatin during anaphase. These two proteins comprise a phosphatase complex that is involved in nuclear envelope reformation and regulation of the DNA damage response. The encoded protein may also play a role in cancer progression. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2015]
Allele List at MGI

All alleles(24) : Gene trapped(24)

Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4430402I18Rik A T 19: 28,945,783 C80S possibly damaging Het
4930415L06Rik A G X: 89,932,303 F96S probably damaging Het
Adgrf3 T C 5: 30,204,362 N44D probably benign Het
AU018091 A G 7: 3,159,122 F375L probably damaging Het
Bsph1 G T 7: 13,458,276 probably null Het
Casp1 A G 9: 5,302,444 D122G probably benign Het
Ccdc146 C T 5: 21,316,943 C361Y probably benign Het
Cdc37l1 T C 19: 28,990,628 S31P possibly damaging Het
Cfap73 C T 5: 120,629,965 probably null Het
Cgnl1 A G 9: 71,705,293 L749S probably damaging Het
Cmtr2 C A 8: 110,221,830 C257* probably null Het
Col6a4 A T 9: 106,072,411 L675* probably null Het
Cpne8 A T 15: 90,572,001 D186E probably damaging Het
Csmd3 A G 15: 47,755,966 probably null Het
D330045A20Rik C T X: 139,507,003 S364L probably damaging Het
D430042O09Rik A G 7: 125,868,741 I1366V probably benign Het
Daglb T A 5: 143,487,151 Y354N possibly damaging Het
Dlgap1 T C 17: 70,761,080 S549P probably damaging Het
Dnah11 T C 12: 117,879,943 D4389G probably damaging Het
Dst T A 1: 34,190,684 C2631S probably benign Het
Gimap1 T A 6: 48,743,242 W263R probably damaging Het
Gne A C 4: 44,040,383 C594G possibly damaging Het
Gtf2a1 T C 12: 91,575,667 H47R probably benign Het
Hdac6 T C X: 7,931,492 T993A probably benign Het
Helz2 T C 2: 181,229,710 D2703G probably benign Het
Jmjd1c G A 10: 67,219,466 V222I possibly damaging Het
Kndc1 A G 7: 139,924,129 E1116G probably benign Het
Krt10 C T 11: 99,386,993 probably null Het
Lrrc37a T G 11: 103,498,653 H1982P possibly damaging Het
Med13l T A 5: 118,593,463 L68Q probably damaging Het
Megf10 C A 18: 57,259,798 D422E probably damaging Het
Mpz C T 1: 171,159,771 probably benign Het
Muc5ac A T 7: 141,807,478 T1508S possibly damaging Het
Myo3a C T 2: 22,333,539 probably benign Het
Ndnf A T 6: 65,703,936 N400Y possibly damaging Het
Olfr192 G A 16: 59,098,761 T77I unknown Het
Olfr414 T C 1: 174,431,091 I221T probably damaging Het
Olfr855 G T 9: 19,584,995 V153F probably benign Het
Otol1 A G 3: 70,027,779 D368G probably damaging Het
Pappa A G 4: 65,314,587 N1321S probably benign Het
Patl1 T A 19: 11,942,950 L756Q probably damaging Het
Plcg2 A G 8: 117,612,978 M1043V probably benign Het
Plekhg2 G A 7: 28,364,719 probably benign Het
Ppp2r2d G A 7: 138,882,416 W265* probably null Het
Prss40 G T 1: 34,560,879 S9* probably null Het
Radil T A 5: 142,494,233 I471F probably benign Het
Rpl10l A T 12: 66,284,203 M52K probably damaging Het
Scn1a A T 2: 66,326,036 S510T possibly damaging Het
Sdad1 T G 5: 92,302,694 N194T probably damaging Het
Sel1l3 A T 5: 53,188,054 Y259* probably null Het
Slc22a26 T C 19: 7,788,329 probably null Het
Snap91 C T 9: 86,777,049 G477D probably damaging Het
Srr T C 11: 74,909,121 T202A probably benign Het
Srrm1 C T 4: 135,340,931 probably benign Het
Trp53bp2 T A 1: 182,449,061 L869Q possibly damaging Het
Ttbk1 T A 17: 46,446,762 D982V probably benign Het
Ttn T C 2: 76,794,157 T15324A probably benign Het
Ush1c T C 7: 46,221,528 E276G probably damaging Het
Vcan T A 13: 89,692,543 L1627F probably benign Het
Vps8 A C 16: 21,526,396 D823A probably damaging Het
Zfp616 T A 11: 74,085,282 N792K possibly damaging Het
Zfpm2 A T 15: 40,870,627 D2V possibly damaging Het
Zfyve16 A C 13: 92,513,763 probably null Het
Zmym2 T A 14: 56,958,308 probably benign Het
Other mutations in Cdca2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01115:Cdca2 APN 14 67714697 missense probably damaging 0.99
IGL01413:Cdca2 APN 14 67677894 missense probably damaging 0.98
IGL01962:Cdca2 APN 14 67705723 missense probably damaging 0.99
IGL01982:Cdca2 APN 14 67677719 missense probably damaging 0.98
IGL02198:Cdca2 APN 14 67694996 missense probably benign 0.00
IGL02208:Cdca2 APN 14 67713140 missense probably damaging 0.99
IGL02883:Cdca2 APN 14 67707497 missense probably damaging 1.00
IGL03069:Cdca2 APN 14 67714936 splice site probably benign
F5493:Cdca2 UTSW 14 67677692 missense probably damaging 0.99
IGL03046:Cdca2 UTSW 14 67700022 intron probably benign
R0254:Cdca2 UTSW 14 67677178 missense probably damaging 0.99
R0350:Cdca2 UTSW 14 67713119 missense probably benign 0.02
R0368:Cdca2 UTSW 14 67700347 missense possibly damaging 0.89
R0398:Cdca2 UTSW 14 67697962 missense probably damaging 0.98
R0790:Cdca2 UTSW 14 67680291 missense probably benign
R1104:Cdca2 UTSW 14 67693682 missense probably damaging 0.99
R1474:Cdca2 UTSW 14 67714906 intron probably benign
R1658:Cdca2 UTSW 14 67677699 missense possibly damaging 0.93
R1782:Cdca2 UTSW 14 67677811 missense probably benign 0.22
R2150:Cdca2 UTSW 14 67714809 missense probably damaging 1.00
R2154:Cdca2 UTSW 14 67676976 missense probably damaging 0.99
R2155:Cdca2 UTSW 14 67714838 missense probably damaging 1.00
R2862:Cdca2 UTSW 14 67698090 missense probably damaging 1.00
R3156:Cdca2 UTSW 14 67698163 missense possibly damaging 0.91
R3840:Cdca2 UTSW 14 67680271 nonsense probably null
R4293:Cdca2 UTSW 14 67714850 missense probably benign 0.06
R4679:Cdca2 UTSW 14 67714966 missense possibly damaging 0.68
R4777:Cdca2 UTSW 14 67713140 missense probably damaging 0.99
R4829:Cdca2 UTSW 14 67693753 critical splice acceptor site probably null
R4843:Cdca2 UTSW 14 67676976 missense probably damaging 1.00
R5031:Cdca2 UTSW 14 67713153 missense probably damaging 1.00
R5181:Cdca2 UTSW 14 67680165 missense probably damaging 0.98
R5331:Cdca2 UTSW 14 67677471 missense possibly damaging 0.91
R5490:Cdca2 UTSW 14 67680284 missense possibly damaging 0.91
R5695:Cdca2 UTSW 14 67705629 critical splice donor site probably null
R6246:Cdca2 UTSW 14 67677828 nonsense probably null
R6866:Cdca2 UTSW 14 67693666 missense possibly damaging 0.92
R6928:Cdca2 UTSW 14 67705744 missense probably damaging 0.98
R6955:Cdca2 UTSW 14 67715004 start codon destroyed probably null 0.53
R6986:Cdca2 UTSW 14 67694997 missense probably benign 0.27
R7080:Cdca2 UTSW 14 67698102 missense probably damaging 0.99
R7092:Cdca2 UTSW 14 67707351 critical splice donor site probably null
R7292:Cdca2 UTSW 14 67677877 nonsense probably null
R7308:Cdca2 UTSW 14 67694991 missense probably benign
R7310:Cdca2 UTSW 14 67713224 missense probably damaging 1.00
R7877:Cdca2 UTSW 14 67677216 missense probably benign
R7960:Cdca2 UTSW 14 67677216 missense probably benign
R8012:Cdca2 UTSW 14 67677372 missense probably benign 0.23
Z1088:Cdca2 UTSW 14 67700298 missense probably benign 0.12
Z1177:Cdca2 UTSW 14 67680244 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAGTTGTCAGGTTGGCAGAG -3'
(R):5'- ATGCCTGCTATGAGATCAGTG -3'

Sequencing Primer
(F):5'- CCCAACTCATACTTTGTGATAGCAG -3'
(R):5'- CCTGCTATGAGATCAGTGGAACTAC -3'
Posted On2015-04-30