Incidental Mutation 'R4044:Prss40'
ID313969
Institutional Source Beutler Lab
Gene Symbol Prss40
Ensembl Gene ENSMUSG00000037529
Gene Nameprotease, serine 40
SynonymsTesp2
MMRRC Submission 040967-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4044 (G1)
Quality Score214
Status Validated
Chromosome1
Chromosomal Location34543968-34560943 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to T at 34560879 bp
ZygosityHeterozygous
Amino Acid Change Serine to Stop codon at position 9 (S9*)
Ref Sequence ENSEMBL: ENSMUSP00000110723 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047840] [ENSMUST00000115071] [ENSMUST00000190790]
Predicted Effect probably null
Transcript: ENSMUST00000047840
AA Change: S9*
SMART Domains Protein: ENSMUSP00000045118
Gene: ENSMUSG00000037529
AA Change: S9*

DomainStartEndE-ValueType
low complexity region 10 24 N/A INTRINSIC
Tryp_SPc 68 308 1.45e-71 SMART
low complexity region 309 319 N/A INTRINSIC
low complexity region 354 365 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000115071
AA Change: S9*
SMART Domains Protein: ENSMUSP00000110723
Gene: ENSMUSG00000037529
AA Change: S9*

DomainStartEndE-ValueType
Tryp_SPc 1 146 8.36e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000190790
SMART Domains Protein: ENSMUSP00000140885
Gene: ENSMUSG00000037529

DomainStartEndE-ValueType
Tryp_SPc 4 145 2.3e-7 SMART
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.5%
Validation Efficiency 100% (45/45)
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4430402I18Rik A T 19: 28,945,783 C80S possibly damaging Het
4930579C12Rik T A 9: 89,162,294 noncoding transcript Het
9130011E15Rik A T 19: 45,820,324 Y643N probably damaging Het
Ada A T 2: 163,735,460 I36N probably damaging Het
Atg7 T C 6: 114,701,978 V384A probably benign Het
Ccl1 T A 11: 82,179,693 I18L probably benign Het
Cep70 T A 9: 99,262,609 C66S possibly damaging Het
D16Ertd472e A T 16: 78,576,006 D14E probably damaging Het
D330045A20Rik C T X: 139,507,003 S364L probably damaging Het
D430042O09Rik A G 7: 125,868,741 I1366V probably benign Het
Dnah9 T C 11: 66,133,635 K278E probably benign Het
Dsg1a C A 18: 20,324,030 N153K probably damaging Het
Galnt5 T A 2: 57,998,460 I24N probably damaging Het
Gm13084 T A 4: 143,811,600 N267I probably benign Het
Grid1 A T 14: 35,450,401 probably benign Het
Gtf2a1 T C 12: 91,575,667 H47R probably benign Het
Igf1r A G 7: 68,190,062 T706A possibly damaging Het
Itih4 A T 14: 30,895,038 N517I probably damaging Het
Jam3 C A 9: 27,101,863 probably null Het
Klk1b4 A G 7: 44,210,755 M98V probably benign Het
Kndc1 A G 7: 139,924,129 E1116G probably benign Het
Ksr2 C T 5: 117,555,062 R192* probably null Het
L3mbtl4 T C 17: 68,777,914 S607P possibly damaging Het
Map6 T C 7: 99,268,049 C10R probably damaging Het
Mpp5 G A 12: 78,824,839 E398K probably benign Het
Myo3a A G 2: 22,577,700 E322G probably damaging Het
Nell1 A G 7: 50,219,619 N214S probably damaging Het
Npm3 T C 19: 45,748,253 E149G possibly damaging Het
Olfr1277 C T 2: 111,269,582 V262I probably benign Het
Olfr192 G A 16: 59,098,761 T77I unknown Het
Orc3 G A 4: 34,587,055 Q345* probably null Het
Otol1 A G 3: 70,027,779 D368G probably damaging Het
Reln A T 5: 22,128,632 V264D possibly damaging Het
Rpp40 A G 13: 35,898,566 C275R probably benign Het
Scaf1 G A 7: 45,006,374 probably benign Het
Sncaip A G 18: 52,907,403 T890A probably benign Het
Sssca1 T C 19: 5,730,403 E189G probably damaging Het
Thada A G 17: 84,441,707 V612A probably benign Het
Tsnaxip1 G A 8: 105,833,545 probably null Het
Vcan T A 13: 89,692,543 L1627F probably benign Het
Vrtn T C 12: 84,649,070 I198T probably damaging Het
Wnt9b T C 11: 103,731,998 D193G probably damaging Het
Zswim5 A G 4: 116,986,702 D979G probably damaging Het
Other mutations in Prss40
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00647:Prss40 APN 1 34552539 missense probably benign 0.01
IGL01298:Prss40 APN 1 34560766 missense probably benign
IGL01694:Prss40 APN 1 34556097 missense probably benign 0.02
IGL03030:Prss40 APN 1 34558101 missense probably damaging 0.99
IGL03393:Prss40 APN 1 34558101 missense probably damaging 0.99
R0294:Prss40 UTSW 1 34556081 missense possibly damaging 0.58
R1450:Prss40 UTSW 1 34556097 missense probably benign 0.02
R1987:Prss40 UTSW 1 34558014 missense possibly damaging 0.75
R2356:Prss40 UTSW 1 34559903 nonsense probably null
R2395:Prss40 UTSW 1 34559905 missense possibly damaging 0.86
R4042:Prss40 UTSW 1 34560879 nonsense probably null
R4043:Prss40 UTSW 1 34560879 nonsense probably null
R4232:Prss40 UTSW 1 34560792 missense probably benign 0.07
R5418:Prss40 UTSW 1 34560759 missense probably benign 0.00
R5539:Prss40 UTSW 1 34552679 makesense probably null
R5719:Prss40 UTSW 1 34552517 utr 3 prime probably benign
R6365:Prss40 UTSW 1 34552517 utr 3 prime probably benign
R7002:Prss40 UTSW 1 34552400 splice site probably null
R7366:Prss40 UTSW 1 34559871 nonsense probably null
R7521:Prss40 UTSW 1 34558009 missense probably benign 0.03
R7777:Prss40 UTSW 1 34552765 nonsense probably null
R8138:Prss40 UTSW 1 34557999 missense probably damaging 0.99
R8360:Prss40 UTSW 1 34560795 missense probably benign 0.00
R8542:Prss40 UTSW 1 34557886 missense probably damaging 1.00
Z1176:Prss40 UTSW 1 34559779 missense possibly damaging 0.85
Z1177:Prss40 UTSW 1 34552586 missense probably benign 0.00
Z1177:Prss40 UTSW 1 34560819 nonsense probably null
Predicted Primers PCR Primer
(F):5'- CCTCCGACTTTAAAGGCCAC -3'
(R):5'- ACACACTCAGAATTGTTTCCGTG -3'

Sequencing Primer
(F):5'- AGGCCACCCTTGCTCCTG -3'
(R):5'- CTCAGAATTGTTTCCGTGAAAGCCAG -3'
Posted On2015-04-30