Incidental Mutation 'R4044:Igf1r'
ID313984
Institutional Source Beutler Lab
Gene Symbol Igf1r
Ensembl Gene ENSMUSG00000005533
Gene Nameinsulin-like growth factor I receptor
Synonymsline 186, A330103N21Rik, CD221, hyft, IGF-1R
MMRRC Submission 040967-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4044 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location67952827-68233668 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 68190062 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 706 (T706A)
Ref Sequence ENSEMBL: ENSMUSP00000005671 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000005671]
Predicted Effect possibly damaging
Transcript: ENSMUST00000005671
AA Change: T706A

PolyPhen 2 Score 0.830 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000005671
Gene: ENSMUSG00000005533
AA Change: T706A

DomainStartEndE-ValueType
Pfam:Recep_L_domain 51 161 1.6e-29 PFAM
FU 227 270 2.98e-12 SMART
Pfam:Recep_L_domain 353 467 3.8e-32 PFAM
FN3 490 593 4.67e-2 SMART
FN3 612 815 1.95e-4 SMART
FN3 833 915 7.4e-5 SMART
low complexity region 937 954 N/A INTRINSIC
TyrKc 1000 1268 8.51e-141 SMART
low complexity region 1285 1303 N/A INTRINSIC
low complexity region 1306 1319 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000207487
Predicted Effect noncoding transcript
Transcript: ENSMUST00000207621
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208348
Meta Mutation Damage Score 0.0723 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.5%
Validation Efficiency 100% (45/45)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This receptor binds insulin-like growth factor with a high affinity. It has tyrosine kinase activity. The insulin-like growth factor I receptor plays a critical role in transformation events. Cleavage of the precursor generates alpha and beta subunits. It is highly overexpressed in most malignant tissues where it functions as an anti-apoptotic agent by enhancing cell survival. Alternatively spliced transcript variants encoding distinct isoforms have been found for this gene. [provided by RefSeq, May 2014]
PHENOTYPE: Targeted null mutants die at birth of respiratory failure; fetuses exhibit retarded growth, organ hypoplasia, ossification delay and nervous system and epidermal abnormalities. hyft homozygous fetuses are growth retarded and exhibit hydrops fetalis and focal hepatic ischemia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4430402I18Rik A T 19: 28,945,783 C80S possibly damaging Het
4930579C12Rik T A 9: 89,162,294 noncoding transcript Het
9130011E15Rik A T 19: 45,820,324 Y643N probably damaging Het
Ada A T 2: 163,735,460 I36N probably damaging Het
Atg7 T C 6: 114,701,978 V384A probably benign Het
Ccl1 T A 11: 82,179,693 I18L probably benign Het
Cep70 T A 9: 99,262,609 C66S possibly damaging Het
D16Ertd472e A T 16: 78,576,006 D14E probably damaging Het
D330045A20Rik C T X: 139,507,003 S364L probably damaging Het
D430042O09Rik A G 7: 125,868,741 I1366V probably benign Het
Dnah9 T C 11: 66,133,635 K278E probably benign Het
Dsg1a C A 18: 20,324,030 N153K probably damaging Het
Galnt5 T A 2: 57,998,460 I24N probably damaging Het
Gm13084 T A 4: 143,811,600 N267I probably benign Het
Grid1 A T 14: 35,450,401 probably benign Het
Gtf2a1 T C 12: 91,575,667 H47R probably benign Het
Itih4 A T 14: 30,895,038 N517I probably damaging Het
Jam3 C A 9: 27,101,863 probably null Het
Klk1b4 A G 7: 44,210,755 M98V probably benign Het
Kndc1 A G 7: 139,924,129 E1116G probably benign Het
Ksr2 C T 5: 117,555,062 R192* probably null Het
L3mbtl4 T C 17: 68,777,914 S607P possibly damaging Het
Map6 T C 7: 99,268,049 C10R probably damaging Het
Mpp5 G A 12: 78,824,839 E398K probably benign Het
Myo3a A G 2: 22,577,700 E322G probably damaging Het
Nell1 A G 7: 50,219,619 N214S probably damaging Het
Npm3 T C 19: 45,748,253 E149G possibly damaging Het
Olfr1277 C T 2: 111,269,582 V262I probably benign Het
Olfr192 G A 16: 59,098,761 T77I unknown Het
Orc3 G A 4: 34,587,055 Q345* probably null Het
Otol1 A G 3: 70,027,779 D368G probably damaging Het
Prss40 G T 1: 34,560,879 S9* probably null Het
Reln A T 5: 22,128,632 V264D possibly damaging Het
Rpp40 A G 13: 35,898,566 C275R probably benign Het
Scaf1 G A 7: 45,006,374 probably benign Het
Sncaip A G 18: 52,907,403 T890A probably benign Het
Sssca1 T C 19: 5,730,403 E189G probably damaging Het
Thada A G 17: 84,441,707 V612A probably benign Het
Tsnaxip1 G A 8: 105,833,545 probably null Het
Vcan T A 13: 89,692,543 L1627F probably benign Het
Vrtn T C 12: 84,649,070 I198T probably damaging Het
Wnt9b T C 11: 103,731,998 D193G probably damaging Het
Zswim5 A G 4: 116,986,702 D979G probably damaging Het
Other mutations in Igf1r
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00742:Igf1r APN 7 68190023 missense probably benign
IGL00837:Igf1r APN 7 68201352 splice site probably benign
IGL01515:Igf1r APN 7 68207452 missense probably damaging 1.00
IGL01572:Igf1r APN 7 68193441 missense probably benign 0.01
IGL02100:Igf1r APN 7 68189958 missense probably benign 0.05
IGL02506:Igf1r APN 7 68193396 missense probably benign
IGL02672:Igf1r APN 7 68190033 missense probably benign 0.05
IGL02701:Igf1r APN 7 68201249 missense possibly damaging 0.93
IGL02742:Igf1r APN 7 68189991 missense possibly damaging 0.94
IGL03073:Igf1r APN 7 68215043 missense probably damaging 1.00
IGL03257:Igf1r APN 7 68214940 missense probably damaging 1.00
Frufru UTSW 7 68004163 missense probably damaging 1.00
Mimi UTSW 7 68195026 missense possibly damaging 0.67
FR4548:Igf1r UTSW 7 68226186 small insertion probably benign
FR4737:Igf1r UTSW 7 68226181 small insertion probably benign
FR4976:Igf1r UTSW 7 68226181 small insertion probably benign
FR4976:Igf1r UTSW 7 68226186 small insertion probably benign
PIT4445001:Igf1r UTSW 7 68207463 missense probably damaging 1.00
R0003:Igf1r UTSW 7 68165242 missense probably damaging 1.00
R0184:Igf1r UTSW 7 68226193 missense possibly damaging 0.84
R0538:Igf1r UTSW 7 68207826 missense probably damaging 1.00
R0632:Igf1r UTSW 7 68165155 missense probably damaging 1.00
R0727:Igf1r UTSW 7 68212158 critical splice donor site probably null
R0750:Igf1r UTSW 7 68212091 missense probably damaging 0.99
R1104:Igf1r UTSW 7 68195026 missense possibly damaging 0.67
R1169:Igf1r UTSW 7 68165127 missense probably benign 0.00
R1348:Igf1r UTSW 7 68218468 missense probably damaging 1.00
R1471:Igf1r UTSW 7 68003837 missense probably damaging 0.98
R1580:Igf1r UTSW 7 68207869 missense probably benign
R1745:Igf1r UTSW 7 68169913 missense probably damaging 1.00
R1772:Igf1r UTSW 7 68195074 missense probably benign 0.03
R1789:Igf1r UTSW 7 68214933 nonsense probably null
R1823:Igf1r UTSW 7 68194981 missense possibly damaging 0.77
R1902:Igf1r UTSW 7 68201249 missense possibly damaging 0.93
R1962:Igf1r UTSW 7 68207275 missense probably damaging 0.99
R2179:Igf1r UTSW 7 68003950 missense probably damaging 0.99
R2215:Igf1r UTSW 7 68165234 missense probably benign
R2221:Igf1r UTSW 7 68201962 missense probably damaging 1.00
R2233:Igf1r UTSW 7 68212080 missense probably damaging 1.00
R2234:Igf1r UTSW 7 68212080 missense probably damaging 1.00
R2235:Igf1r UTSW 7 68212080 missense probably damaging 1.00
R3023:Igf1r UTSW 7 68183399 missense probably benign 0.00
R4226:Igf1r UTSW 7 68195078 nonsense probably null
R4387:Igf1r UTSW 7 68170009 missense probably benign
R4388:Igf1r UTSW 7 68170009 missense probably benign
R4728:Igf1r UTSW 7 68189624 missense probably damaging 1.00
R4781:Igf1r UTSW 7 68165199 missense possibly damaging 0.75
R5254:Igf1r UTSW 7 68207319 missense probably damaging 0.99
R5278:Igf1r UTSW 7 68193418 missense possibly damaging 0.78
R5510:Igf1r UTSW 7 68193359 missense probably benign 0.19
R5522:Igf1r UTSW 7 68183510 missense probably damaging 0.96
R5527:Igf1r UTSW 7 68207821 missense probably damaging 1.00
R5761:Igf1r UTSW 7 68207253 missense probably damaging 1.00
R5849:Igf1r UTSW 7 68190033 missense probably benign
R6189:Igf1r UTSW 7 68207336 nonsense probably null
R6262:Igf1r UTSW 7 68003972 missense probably damaging 1.00
R6285:Igf1r UTSW 7 68004137 missense possibly damaging 0.94
R6318:Igf1r UTSW 7 68165233 missense probably benign 0.02
R6365:Igf1r UTSW 7 68190050 missense probably benign 0.26
R6377:Igf1r UTSW 7 68201250 missense probably benign 0.00
R6831:Igf1r UTSW 7 68207319 missense possibly damaging 0.75
R6848:Igf1r UTSW 7 68004179 missense probably damaging 1.00
R6902:Igf1r UTSW 7 68004163 missense probably damaging 1.00
R7193:Igf1r UTSW 7 68187157 missense probably damaging 1.00
R7373:Igf1r UTSW 7 68195078 nonsense probably null
R7442:Igf1r UTSW 7 68173278 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTCTCAGCAGTGCACACCAG -3'
(R):5'- CCTGTCAGCTGACTGCAATAGC -3'

Sequencing Primer
(F):5'- TCCACCAGCAATGCTAACAGG -3'
(R):5'- ATAGCAGCCCAGCAGCCTG -3'
Posted On2015-04-30