Incidental Mutation 'R4044:Map6'
ID 313985
Institutional Source Beutler Lab
Gene Symbol Map6
Ensembl Gene ENSMUSG00000055407
Gene Name microtubule-associated protein 6
Synonyms F-STOP, Mtap6, 2810411E12Rik, STOP
MMRRC Submission 040967-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.091) question?
Stock # R4044 (G1)
Quality Score 191
Status Validated
Chromosome 7
Chromosomal Location 99267447-99337137 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 99268049 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Cysteine to Arginine at position 10 (C10R)
Ref Sequence ENSEMBL: ENSMUSP00000146585 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000068973] [ENSMUST00000107100] [ENSMUST00000122101] [ENSMUST00000127492] [ENSMUST00000207883] [ENSMUST00000208605] [ENSMUST00000208924]
AlphaFold Q7TSJ2
Predicted Effect probably damaging
Transcript: ENSMUST00000068973
AA Change: C10R

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000064787
Gene: ENSMUSG00000055407
AA Change: C10R

DomainStartEndE-ValueType
low complexity region 42 57 N/A INTRINSIC
low complexity region 93 117 N/A INTRINSIC
internal_repeat_1 191 306 6.21e-27 PROSPERO
internal_repeat_1 302 398 6.21e-27 PROSPERO
low complexity region 501 525 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000107100
SMART Domains Protein: ENSMUSP00000102717
Gene: ENSMUSG00000055407

DomainStartEndE-ValueType
low complexity region 12 26 N/A INTRINSIC
internal_repeat_1 28 103 5.9e-29 PROSPERO
internal_repeat_1 120 195 5.9e-29 PROSPERO
Predicted Effect probably damaging
Transcript: ENSMUST00000122101
AA Change: C10R

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000113183
Gene: ENSMUSG00000055407
AA Change: C10R

DomainStartEndE-ValueType
Pfam:STOP 1 184 1.2e-18 PFAM
internal_repeat_1 191 306 1.99e-35 PROSPERO
internal_repeat_1 302 398 1.99e-35 PROSPERO
Predicted Effect probably damaging
Transcript: ENSMUST00000127492
AA Change: C10R

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000180761
Predicted Effect probably damaging
Transcript: ENSMUST00000207883
AA Change: C10R

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect probably benign
Transcript: ENSMUST00000208605
Predicted Effect probably benign
Transcript: ENSMUST00000208924
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208978
Predicted Effect noncoding transcript
Transcript: ENSMUST00000209094
Meta Mutation Damage Score 0.9576 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.5%
Validation Efficiency 100% (45/45)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a microtubule-associated protein. The encoded protein is a calmodulin-binding and calmodulin-regulated protein that is involved in microtubule stabilization. Two transcript variants encoding distinct isoforms have been identified for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a targeted null mutation are devoid of cold-stable microtubules, and exhibit impaired synaptic plasticity, associated with severe behavioral abnormalities that are specifically ameliorated by long-term administration of neuroleptics. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4430402I18Rik A T 19: 28,945,783 C80S possibly damaging Het
4930579C12Rik T A 9: 89,162,294 noncoding transcript Het
9130011E15Rik A T 19: 45,820,324 Y643N probably damaging Het
Ada A T 2: 163,735,460 I36N probably damaging Het
Atg7 T C 6: 114,701,978 V384A probably benign Het
Ccl1 T A 11: 82,179,693 I18L probably benign Het
Cep70 T A 9: 99,262,609 C66S possibly damaging Het
D16Ertd472e A T 16: 78,576,006 D14E probably damaging Het
D330045A20Rik C T X: 139,507,003 S364L probably damaging Het
D430042O09Rik A G 7: 125,868,741 I1366V probably benign Het
Dnah9 T C 11: 66,133,635 K278E probably benign Het
Dsg1a C A 18: 20,324,030 N153K probably damaging Het
Galnt5 T A 2: 57,998,460 I24N probably damaging Het
Gm13084 T A 4: 143,811,600 N267I probably benign Het
Grid1 A T 14: 35,450,401 probably benign Het
Gtf2a1 T C 12: 91,575,667 H47R probably benign Het
Igf1r A G 7: 68,190,062 T706A possibly damaging Het
Itih4 A T 14: 30,895,038 N517I probably damaging Het
Jam3 C A 9: 27,101,863 probably null Het
Klk1b4 A G 7: 44,210,755 M98V probably benign Het
Kndc1 A G 7: 139,924,129 E1116G probably benign Het
Ksr2 C T 5: 117,555,062 R192* probably null Het
L3mbtl4 T C 17: 68,777,914 S607P possibly damaging Het
Mpp5 G A 12: 78,824,839 E398K probably benign Het
Myo3a A G 2: 22,577,700 E322G probably damaging Het
Nell1 A G 7: 50,219,619 N214S probably damaging Het
Npm3 T C 19: 45,748,253 E149G possibly damaging Het
Olfr1277 C T 2: 111,269,582 V262I probably benign Het
Olfr192 G A 16: 59,098,761 T77I unknown Het
Orc3 G A 4: 34,587,055 Q345* probably null Het
Otol1 A G 3: 70,027,779 D368G probably damaging Het
Prss40 G T 1: 34,560,879 S9* probably null Het
Reln A T 5: 22,128,632 V264D possibly damaging Het
Rpp40 A G 13: 35,898,566 C275R probably benign Het
Scaf1 G A 7: 45,006,374 probably benign Het
Sncaip A G 18: 52,907,403 T890A probably benign Het
Sssca1 T C 19: 5,730,403 E189G probably damaging Het
Thada A G 17: 84,441,707 V612A probably benign Het
Tsnaxip1 G A 8: 105,833,545 probably null Het
Vcan T A 13: 89,692,543 L1627F probably benign Het
Vrtn T C 12: 84,649,070 I198T probably damaging Het
Wnt9b T C 11: 103,731,998 D193G probably damaging Het
Zswim5 A G 4: 116,986,702 D979G probably damaging Het
Other mutations in Map6
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0035:Map6 UTSW 7 99317608 missense probably damaging 1.00
R0035:Map6 UTSW 7 99317608 missense probably damaging 1.00
R0118:Map6 UTSW 7 99317617 missense possibly damaging 0.53
R0125:Map6 UTSW 7 99335980 splice site probably null
R0244:Map6 UTSW 7 99336836 missense probably benign 0.00
R0973:Map6 UTSW 7 99336743 missense possibly damaging 0.78
R0973:Map6 UTSW 7 99336743 missense possibly damaging 0.78
R0974:Map6 UTSW 7 99336743 missense possibly damaging 0.78
R1455:Map6 UTSW 7 99268214 missense probably damaging 1.00
R1678:Map6 UTSW 7 99268098 missense probably damaging 1.00
R1696:Map6 UTSW 7 99317457 splice site probably null
R1866:Map6 UTSW 7 99315876 missense probably damaging 1.00
R2061:Map6 UTSW 7 99317472 missense probably damaging 1.00
R3236:Map6 UTSW 7 99336824 missense probably damaging 1.00
R3625:Map6 UTSW 7 99269195 missense possibly damaging 0.60
R4570:Map6 UTSW 7 99336556 missense possibly damaging 0.49
R5056:Map6 UTSW 7 99336652 missense probably benign 0.05
R5065:Map6 UTSW 7 99336710 missense probably benign 0.02
R5656:Map6 UTSW 7 99336298 missense probably damaging 1.00
R6101:Map6 UTSW 7 99268107 missense probably damaging 1.00
R6105:Map6 UTSW 7 99268107 missense probably damaging 1.00
R6302:Map6 UTSW 7 99336107 missense probably damaging 0.99
R6450:Map6 UTSW 7 99268038 missense probably damaging 1.00
R6915:Map6 UTSW 7 99268247 missense probably damaging 1.00
R7205:Map6 UTSW 7 99269050 missense probably benign 0.00
R7223:Map6 UTSW 7 99268025 missense probably damaging 1.00
R7293:Map6 UTSW 7 99336533 missense possibly damaging 0.49
R7481:Map6 UTSW 7 99269138 missense possibly damaging 0.57
R7489:Map6 UTSW 7 99268061 missense probably damaging 1.00
R7691:Map6 UTSW 7 99336292 missense possibly damaging 0.95
R7693:Map6 UTSW 7 99336292 missense possibly damaging 0.95
R7695:Map6 UTSW 7 99336292 missense possibly damaging 0.95
R8341:Map6 UTSW 7 99268440 missense possibly damaging 0.75
R8865:Map6 UTSW 7 99268985 missense probably benign 0.37
R8953:Map6 UTSW 7 99315871 missense probably damaging 1.00
R9108:Map6 UTSW 7 99336896 missense probably damaging 1.00
R9173:Map6 UTSW 7 99268728 missense probably damaging 1.00
R9613:Map6 UTSW 7 99269177 missense possibly damaging 0.90
R9654:Map6 UTSW 7 99336959 missense probably damaging 1.00
Z1176:Map6 UTSW 7 99317660 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATCTCAGCGGTACCTTGTCC -3'
(R):5'- GAAGTCCTTCTGGTACTGGGTCTC -3'

Sequencing Primer
(F):5'- TCCCCGGGTGCTCTTTGAG -3'
(R):5'- TAGTCCTGTCGCATCACCGAG -3'
Posted On 2015-04-30