Incidental Mutation 'R4044:Map6'
ID 313985
Institutional Source Beutler Lab
Gene Symbol Map6
Ensembl Gene ENSMUSG00000055407
Gene Name microtubule-associated protein 6
Synonyms Mtap6, 2810411E12Rik, F-STOP, STOP
MMRRC Submission 040967-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.107) question?
Stock # R4044 (G1)
Quality Score 191
Status Validated
Chromosome 7
Chromosomal Location 98916654-98986344 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 98917256 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Cysteine to Arginine at position 10 (C10R)
Ref Sequence ENSEMBL: ENSMUSP00000146585 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000068973] [ENSMUST00000107100] [ENSMUST00000122101] [ENSMUST00000127492] [ENSMUST00000207883] [ENSMUST00000208605] [ENSMUST00000208924]
AlphaFold Q7TSJ2
Predicted Effect probably damaging
Transcript: ENSMUST00000068973
AA Change: C10R

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000064787
Gene: ENSMUSG00000055407
AA Change: C10R

DomainStartEndE-ValueType
low complexity region 42 57 N/A INTRINSIC
low complexity region 93 117 N/A INTRINSIC
internal_repeat_1 191 306 6.21e-27 PROSPERO
internal_repeat_1 302 398 6.21e-27 PROSPERO
low complexity region 501 525 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000107100
SMART Domains Protein: ENSMUSP00000102717
Gene: ENSMUSG00000055407

DomainStartEndE-ValueType
low complexity region 12 26 N/A INTRINSIC
internal_repeat_1 28 103 5.9e-29 PROSPERO
internal_repeat_1 120 195 5.9e-29 PROSPERO
Predicted Effect probably damaging
Transcript: ENSMUST00000122101
AA Change: C10R

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000113183
Gene: ENSMUSG00000055407
AA Change: C10R

DomainStartEndE-ValueType
Pfam:STOP 1 184 1.2e-18 PFAM
internal_repeat_1 191 306 1.99e-35 PROSPERO
internal_repeat_1 302 398 1.99e-35 PROSPERO
Predicted Effect probably damaging
Transcript: ENSMUST00000127492
AA Change: C10R

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000180761
Predicted Effect probably damaging
Transcript: ENSMUST00000207883
AA Change: C10R

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect probably benign
Transcript: ENSMUST00000208605
Predicted Effect probably benign
Transcript: ENSMUST00000208924
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208978
Predicted Effect noncoding transcript
Transcript: ENSMUST00000209094
Meta Mutation Damage Score 0.9576 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.5%
Validation Efficiency 100% (45/45)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a microtubule-associated protein. The encoded protein is a calmodulin-binding and calmodulin-regulated protein that is involved in microtubule stabilization. Two transcript variants encoding distinct isoforms have been identified for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a targeted null mutation are devoid of cold-stable microtubules, and exhibit impaired synaptic plasticity, associated with severe behavioral abnormalities that are specifically ameliorated by long-term administration of neuroleptics. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930579C12Rik T A 9: 89,044,347 (GRCm39) noncoding transcript Het
Ada A T 2: 163,577,380 (GRCm39) I36N probably damaging Het
Armh3 A T 19: 45,808,763 (GRCm39) Y643N probably damaging Het
Atg7 T C 6: 114,678,939 (GRCm39) V384A probably benign Het
Ccl1 T A 11: 82,070,519 (GRCm39) I18L probably benign Het
Cep70 T A 9: 99,144,662 (GRCm39) C66S possibly damaging Het
D16Ertd472e A T 16: 78,372,894 (GRCm39) D14E probably damaging Het
Dnah9 T C 11: 66,024,461 (GRCm39) K278E probably benign Het
Dsg1a C A 18: 20,457,087 (GRCm39) N153K probably damaging Het
Galnt5 T A 2: 57,888,472 (GRCm39) I24N probably damaging Het
Grid1 A T 14: 35,172,358 (GRCm39) probably benign Het
Gtf2a1 T C 12: 91,542,441 (GRCm39) H47R probably benign Het
Igf1r A G 7: 67,839,810 (GRCm39) T706A possibly damaging Het
Itih4 A T 14: 30,616,995 (GRCm39) N517I probably damaging Het
Jam3 C A 9: 27,013,159 (GRCm39) probably null Het
Katnip A G 7: 125,467,913 (GRCm39) I1366V probably benign Het
Klk1b4 A G 7: 43,860,179 (GRCm39) M98V probably benign Het
Kndc1 A G 7: 139,504,044 (GRCm39) E1116G probably benign Het
Ksr2 C T 5: 117,693,127 (GRCm39) R192* probably null Het
L3mbtl4 T C 17: 69,084,909 (GRCm39) S607P possibly damaging Het
Myo3a A G 2: 22,467,712 (GRCm39) E322G probably damaging Het
Nell1 A G 7: 49,869,367 (GRCm39) N214S probably damaging Het
Npm3 T C 19: 45,736,692 (GRCm39) E149G possibly damaging Het
Or4k35 C T 2: 111,099,927 (GRCm39) V262I probably benign Het
Or5h24 G A 16: 58,919,124 (GRCm39) T77I unknown Het
Orc3 G A 4: 34,587,055 (GRCm39) Q345* probably null Het
Otol1 A G 3: 69,935,112 (GRCm39) D368G probably damaging Het
Pals1 G A 12: 78,871,613 (GRCm39) E398K probably benign Het
Pramel26 T A 4: 143,538,170 (GRCm39) N267I probably benign Het
Prss40 G T 1: 34,599,960 (GRCm39) S9* probably null Het
Radx C T X: 138,407,752 (GRCm39) S364L probably damaging Het
Reln A T 5: 22,333,630 (GRCm39) V264D possibly damaging Het
Rpp40 A G 13: 36,082,549 (GRCm39) C275R probably benign Het
Scaf1 G A 7: 44,655,798 (GRCm39) probably benign Het
Sncaip A G 18: 53,040,475 (GRCm39) T890A probably benign Het
Spata6l A T 19: 28,923,183 (GRCm39) C80S possibly damaging Het
Thada A G 17: 84,749,135 (GRCm39) V612A probably benign Het
Tsnaxip1 G A 8: 106,560,177 (GRCm39) probably null Het
Vcan T A 13: 89,840,662 (GRCm39) L1627F probably benign Het
Vrtn T C 12: 84,695,844 (GRCm39) I198T probably damaging Het
Wnt9b T C 11: 103,622,824 (GRCm39) D193G probably damaging Het
Znrd2 T C 19: 5,780,431 (GRCm39) E189G probably damaging Het
Zswim5 A G 4: 116,843,899 (GRCm39) D979G probably damaging Het
Other mutations in Map6
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0035:Map6 UTSW 7 98,966,815 (GRCm39) missense probably damaging 1.00
R0035:Map6 UTSW 7 98,966,815 (GRCm39) missense probably damaging 1.00
R0118:Map6 UTSW 7 98,966,824 (GRCm39) missense possibly damaging 0.53
R0125:Map6 UTSW 7 98,985,187 (GRCm39) splice site probably null
R0244:Map6 UTSW 7 98,986,043 (GRCm39) missense probably benign 0.00
R0973:Map6 UTSW 7 98,985,950 (GRCm39) missense possibly damaging 0.78
R0973:Map6 UTSW 7 98,985,950 (GRCm39) missense possibly damaging 0.78
R0974:Map6 UTSW 7 98,985,950 (GRCm39) missense possibly damaging 0.78
R1455:Map6 UTSW 7 98,917,421 (GRCm39) missense probably damaging 1.00
R1678:Map6 UTSW 7 98,917,305 (GRCm39) missense probably damaging 1.00
R1696:Map6 UTSW 7 98,966,664 (GRCm39) splice site probably null
R1866:Map6 UTSW 7 98,965,083 (GRCm39) missense probably damaging 1.00
R2061:Map6 UTSW 7 98,966,679 (GRCm39) missense probably damaging 1.00
R3236:Map6 UTSW 7 98,986,031 (GRCm39) missense probably damaging 1.00
R3625:Map6 UTSW 7 98,918,402 (GRCm39) missense possibly damaging 0.60
R4570:Map6 UTSW 7 98,985,763 (GRCm39) missense possibly damaging 0.49
R5056:Map6 UTSW 7 98,985,859 (GRCm39) missense probably benign 0.05
R5065:Map6 UTSW 7 98,985,917 (GRCm39) missense probably benign 0.02
R5656:Map6 UTSW 7 98,985,505 (GRCm39) missense probably damaging 1.00
R6101:Map6 UTSW 7 98,917,314 (GRCm39) missense probably damaging 1.00
R6105:Map6 UTSW 7 98,917,314 (GRCm39) missense probably damaging 1.00
R6302:Map6 UTSW 7 98,985,314 (GRCm39) missense probably damaging 0.99
R6450:Map6 UTSW 7 98,917,245 (GRCm39) missense probably damaging 1.00
R6915:Map6 UTSW 7 98,917,454 (GRCm39) missense probably damaging 1.00
R7205:Map6 UTSW 7 98,918,257 (GRCm39) missense probably benign 0.00
R7223:Map6 UTSW 7 98,917,232 (GRCm39) missense probably damaging 1.00
R7293:Map6 UTSW 7 98,985,740 (GRCm39) missense possibly damaging 0.49
R7481:Map6 UTSW 7 98,918,345 (GRCm39) missense possibly damaging 0.57
R7489:Map6 UTSW 7 98,917,268 (GRCm39) missense probably damaging 1.00
R7691:Map6 UTSW 7 98,985,499 (GRCm39) missense possibly damaging 0.95
R7693:Map6 UTSW 7 98,985,499 (GRCm39) missense possibly damaging 0.95
R7695:Map6 UTSW 7 98,985,499 (GRCm39) missense possibly damaging 0.95
R8341:Map6 UTSW 7 98,917,647 (GRCm39) missense possibly damaging 0.75
R8865:Map6 UTSW 7 98,918,192 (GRCm39) missense probably benign 0.37
R8953:Map6 UTSW 7 98,965,078 (GRCm39) missense probably damaging 1.00
R9108:Map6 UTSW 7 98,986,103 (GRCm39) missense probably damaging 1.00
R9173:Map6 UTSW 7 98,917,935 (GRCm39) missense probably damaging 1.00
R9613:Map6 UTSW 7 98,918,384 (GRCm39) missense possibly damaging 0.90
R9654:Map6 UTSW 7 98,986,166 (GRCm39) missense probably damaging 1.00
Z1176:Map6 UTSW 7 98,966,867 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATCTCAGCGGTACCTTGTCC -3'
(R):5'- GAAGTCCTTCTGGTACTGGGTCTC -3'

Sequencing Primer
(F):5'- TCCCCGGGTGCTCTTTGAG -3'
(R):5'- TAGTCCTGTCGCATCACCGAG -3'
Posted On 2015-04-30