Incidental Mutation 'R4044:Tsnaxip1'
ID313988
Institutional Source Beutler Lab
Gene Symbol Tsnaxip1
Ensembl Gene ENSMUSG00000031893
Gene Nametranslin-associated factor X (Tsnax) interacting protein 1
Synonyms1700016K08Rik, TXI1
MMRRC Submission 040967-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.509) question?
Stock #R4044 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location105827731-105844680 bp(+) (GRCm38)
Type of Mutationsplice site (5 bp from exon)
DNA Base Change (assembly) G to A at 105833545 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000148715 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034365] [ENSMUST00000212566]
Predicted Effect probably null
Transcript: ENSMUST00000034365
SMART Domains Protein: ENSMUSP00000034365
Gene: ENSMUSG00000031893

DomainStartEndE-ValueType
Pfam:TSNAXIP1_N 98 209 3.5e-33 PFAM
coiled coil region 304 342 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211949
Predicted Effect probably null
Transcript: ENSMUST00000212566
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.5%
Validation Efficiency 100% (45/45)
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4430402I18Rik A T 19: 28,945,783 C80S possibly damaging Het
4930579C12Rik T A 9: 89,162,294 noncoding transcript Het
9130011E15Rik A T 19: 45,820,324 Y643N probably damaging Het
Ada A T 2: 163,735,460 I36N probably damaging Het
Atg7 T C 6: 114,701,978 V384A probably benign Het
Ccl1 T A 11: 82,179,693 I18L probably benign Het
Cep70 T A 9: 99,262,609 C66S possibly damaging Het
D16Ertd472e A T 16: 78,576,006 D14E probably damaging Het
D330045A20Rik C T X: 139,507,003 S364L probably damaging Het
D430042O09Rik A G 7: 125,868,741 I1366V probably benign Het
Dnah9 T C 11: 66,133,635 K278E probably benign Het
Dsg1a C A 18: 20,324,030 N153K probably damaging Het
Galnt5 T A 2: 57,998,460 I24N probably damaging Het
Gm13084 T A 4: 143,811,600 N267I probably benign Het
Grid1 A T 14: 35,450,401 probably benign Het
Gtf2a1 T C 12: 91,575,667 H47R probably benign Het
Igf1r A G 7: 68,190,062 T706A possibly damaging Het
Itih4 A T 14: 30,895,038 N517I probably damaging Het
Jam3 C A 9: 27,101,863 probably null Het
Klk1b4 A G 7: 44,210,755 M98V probably benign Het
Kndc1 A G 7: 139,924,129 E1116G probably benign Het
Ksr2 C T 5: 117,555,062 R192* probably null Het
L3mbtl4 T C 17: 68,777,914 S607P possibly damaging Het
Map6 T C 7: 99,268,049 C10R probably damaging Het
Mpp5 G A 12: 78,824,839 E398K probably benign Het
Myo3a A G 2: 22,577,700 E322G probably damaging Het
Nell1 A G 7: 50,219,619 N214S probably damaging Het
Npm3 T C 19: 45,748,253 E149G possibly damaging Het
Olfr1277 C T 2: 111,269,582 V262I probably benign Het
Olfr192 G A 16: 59,098,761 T77I unknown Het
Orc3 G A 4: 34,587,055 Q345* probably null Het
Otol1 A G 3: 70,027,779 D368G probably damaging Het
Prss40 G T 1: 34,560,879 S9* probably null Het
Reln A T 5: 22,128,632 V264D possibly damaging Het
Rpp40 A G 13: 35,898,566 C275R probably benign Het
Scaf1 G A 7: 45,006,374 probably benign Het
Sncaip A G 18: 52,907,403 T890A probably benign Het
Sssca1 T C 19: 5,730,403 E189G probably damaging Het
Thada A G 17: 84,441,707 V612A probably benign Het
Vcan T A 13: 89,692,543 L1627F probably benign Het
Vrtn T C 12: 84,649,070 I198T probably damaging Het
Wnt9b T C 11: 103,731,998 D193G probably damaging Het
Zswim5 A G 4: 116,986,702 D979G probably damaging Het
Other mutations in Tsnaxip1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00479:Tsnaxip1 APN 8 105841423 missense probably benign 0.04
IGL00490:Tsnaxip1 APN 8 105842184 missense probably damaging 1.00
IGL00849:Tsnaxip1 APN 8 105842168 missense probably damaging 0.99
IGL01756:Tsnaxip1 APN 8 105842788 splice site probably benign
IGL01821:Tsnaxip1 APN 8 105837516 missense probably damaging 0.96
IGL02278:Tsnaxip1 APN 8 105827781 utr 5 prime probably benign
IGL02290:Tsnaxip1 APN 8 105833487 missense probably benign 0.00
IGL02980:Tsnaxip1 UTSW 8 105842210 missense probably damaging 0.96
R0239:Tsnaxip1 UTSW 8 105844488 missense possibly damaging 0.96
R0239:Tsnaxip1 UTSW 8 105844488 missense possibly damaging 0.96
R1544:Tsnaxip1 UTSW 8 105827751 start gained probably benign
R1939:Tsnaxip1 UTSW 8 105840038 missense probably benign 0.04
R3024:Tsnaxip1 UTSW 8 105841743 missense probably damaging 1.00
R3695:Tsnaxip1 UTSW 8 105833535 missense possibly damaging 0.61
R3853:Tsnaxip1 UTSW 8 105840701 splice site probably benign
R4376:Tsnaxip1 UTSW 8 105841801 nonsense probably null
R4627:Tsnaxip1 UTSW 8 105841407 missense probably damaging 1.00
R4790:Tsnaxip1 UTSW 8 105833523 missense probably benign 0.12
R5806:Tsnaxip1 UTSW 8 105837496 missense possibly damaging 0.83
R5814:Tsnaxip1 UTSW 8 105843971 missense probably benign 0.00
R6045:Tsnaxip1 UTSW 8 105844187 missense probably benign 0.24
R6374:Tsnaxip1 UTSW 8 105841540 missense possibly damaging 0.55
R6406:Tsnaxip1 UTSW 8 105843983 missense probably benign 0.14
R7915:Tsnaxip1 UTSW 8 105842781 missense possibly damaging 0.88
R7918:Tsnaxip1 UTSW 8 105844535 missense probably benign 0.00
R8317:Tsnaxip1 UTSW 8 105827806 missense probably benign 0.07
R8377:Tsnaxip1 UTSW 8 105842547 missense probably damaging 1.00
R8534:Tsnaxip1 UTSW 8 105838738 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGAGTCATGCCCTATGGATTCG -3'
(R):5'- GTCTTTTCTGCCTAGAACAGCTTG -3'

Sequencing Primer
(F):5'- CATGCCCTATGGATTCGGGAAG -3'
(R):5'- TGGGCCCACTTTCAGATCAGTG -3'
Posted On2015-04-30