Incidental Mutation 'R4044:Cep70'
ID313991
Institutional Source Beutler Lab
Gene Symbol Cep70
Ensembl Gene ENSMUSG00000056267
Gene Namecentrosomal protein 70
SynonymsC030018L16Rik, 6720484E09Rik
MMRRC Submission 040967-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.184) question?
Stock #R4044 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location99243367-99300404 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 99262609 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Serine at position 66 (C66S)
Ref Sequence ENSEMBL: ENSMUSP00000141041 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000093795] [ENSMUST00000185799] [ENSMUST00000190078] [ENSMUST00000190715] [ENSMUST00000191014] [ENSMUST00000191335]
Predicted Effect probably benign
Transcript: ENSMUST00000093795
AA Change: C66S

PolyPhen 2 Score 0.010 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000091312
Gene: ENSMUSG00000056267
AA Change: C66S

DomainStartEndE-ValueType
coiled coil region 96 210 N/A INTRINSIC
coiled coil region 278 299 N/A INTRINSIC
low complexity region 319 335 N/A INTRINSIC
low complexity region 528 544 N/A INTRINSIC
low complexity region 591 602 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000185799
AA Change: C66S

PolyPhen 2 Score 0.010 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000139458
Gene: ENSMUSG00000056267
AA Change: C66S

DomainStartEndE-ValueType
coiled coil region 96 156 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000188515
Predicted Effect possibly damaging
Transcript: ENSMUST00000190078
AA Change: C66S

PolyPhen 2 Score 0.663 (Sensitivity: 0.86; Specificity: 0.91)
Predicted Effect probably benign
Transcript: ENSMUST00000190715
AA Change: C66S

PolyPhen 2 Score 0.010 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000140377
Gene: ENSMUSG00000056267
AA Change: C66S

DomainStartEndE-ValueType
coiled coil region 96 157 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000191014
AA Change: C66S

PolyPhen 2 Score 0.010 (Sensitivity: 0.96; Specificity: 0.77)
Predicted Effect probably benign
Transcript: ENSMUST00000191335
AA Change: C66S

PolyPhen 2 Score 0.010 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000139816
Gene: ENSMUSG00000056267
AA Change: C66S

DomainStartEndE-ValueType
coiled coil region 96 210 N/A INTRINSIC
coiled coil region 278 299 N/A INTRINSIC
low complexity region 319 335 N/A INTRINSIC
low complexity region 528 544 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000214024
Predicted Effect noncoding transcript
Transcript: ENSMUST00000214625
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.5%
Validation Efficiency 100% (45/45)
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4430402I18Rik A T 19: 28,945,783 C80S possibly damaging Het
4930579C12Rik T A 9: 89,162,294 noncoding transcript Het
9130011E15Rik A T 19: 45,820,324 Y643N probably damaging Het
Ada A T 2: 163,735,460 I36N probably damaging Het
Atg7 T C 6: 114,701,978 V384A probably benign Het
Ccl1 T A 11: 82,179,693 I18L probably benign Het
D16Ertd472e A T 16: 78,576,006 D14E probably damaging Het
D330045A20Rik C T X: 139,507,003 S364L probably damaging Het
D430042O09Rik A G 7: 125,868,741 I1366V probably benign Het
Dnah9 T C 11: 66,133,635 K278E probably benign Het
Dsg1a C A 18: 20,324,030 N153K probably damaging Het
Galnt5 T A 2: 57,998,460 I24N probably damaging Het
Gm13084 T A 4: 143,811,600 N267I probably benign Het
Grid1 A T 14: 35,450,401 probably benign Het
Gtf2a1 T C 12: 91,575,667 H47R probably benign Het
Igf1r A G 7: 68,190,062 T706A possibly damaging Het
Itih4 A T 14: 30,895,038 N517I probably damaging Het
Jam3 C A 9: 27,101,863 probably null Het
Klk1b4 A G 7: 44,210,755 M98V probably benign Het
Kndc1 A G 7: 139,924,129 E1116G probably benign Het
Ksr2 C T 5: 117,555,062 R192* probably null Het
L3mbtl4 T C 17: 68,777,914 S607P possibly damaging Het
Map6 T C 7: 99,268,049 C10R probably damaging Het
Mpp5 G A 12: 78,824,839 E398K probably benign Het
Myo3a A G 2: 22,577,700 E322G probably damaging Het
Nell1 A G 7: 50,219,619 N214S probably damaging Het
Npm3 T C 19: 45,748,253 E149G possibly damaging Het
Olfr1277 C T 2: 111,269,582 V262I probably benign Het
Olfr192 G A 16: 59,098,761 T77I unknown Het
Orc3 G A 4: 34,587,055 Q345* probably null Het
Otol1 A G 3: 70,027,779 D368G probably damaging Het
Prss40 G T 1: 34,560,879 S9* probably null Het
Reln A T 5: 22,128,632 V264D possibly damaging Het
Rpp40 A G 13: 35,898,566 C275R probably benign Het
Scaf1 G A 7: 45,006,374 probably benign Het
Sncaip A G 18: 52,907,403 T890A probably benign Het
Sssca1 T C 19: 5,730,403 E189G probably damaging Het
Thada A G 17: 84,441,707 V612A probably benign Het
Tsnaxip1 G A 8: 105,833,545 probably null Het
Vcan T A 13: 89,692,543 L1627F probably benign Het
Vrtn T C 12: 84,649,070 I198T probably damaging Het
Wnt9b T C 11: 103,731,998 D193G probably damaging Het
Zswim5 A G 4: 116,986,702 D979G probably damaging Het
Other mutations in Cep70
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01445:Cep70 APN 9 99298500 unclassified probably benign
IGL02719:Cep70 APN 9 99275722 missense probably damaging 0.99
IGL02878:Cep70 APN 9 99281107 splice site probably benign
IGL02969:Cep70 APN 9 99298504 missense possibly damaging 0.88
R0426:Cep70 UTSW 9 99297684 missense probably benign 0.02
R0970:Cep70 UTSW 9 99275599 missense possibly damaging 0.93
R1238:Cep70 UTSW 9 99254265 missense probably benign 0.05
R1462:Cep70 UTSW 9 99263720 missense probably benign 0.20
R1462:Cep70 UTSW 9 99263720 missense probably benign 0.20
R2141:Cep70 UTSW 9 99296385 missense probably damaging 1.00
R3922:Cep70 UTSW 9 99275579 makesense probably null
R3964:Cep70 UTSW 9 99298534 missense probably damaging 1.00
R3965:Cep70 UTSW 9 99298534 missense probably damaging 1.00
R4174:Cep70 UTSW 9 99246313 start gained probably benign
R4659:Cep70 UTSW 9 99296341 missense possibly damaging 0.86
R4672:Cep70 UTSW 9 99254312 missense possibly damaging 0.66
R4839:Cep70 UTSW 9 99296085 missense probably benign 0.16
R5108:Cep70 UTSW 9 99263812 splice site probably null
R5288:Cep70 UTSW 9 99281075 missense probably damaging 1.00
R5386:Cep70 UTSW 9 99281075 missense probably damaging 1.00
R5802:Cep70 UTSW 9 99296405 missense probably damaging 0.96
R5934:Cep70 UTSW 9 99254265 missense probably benign 0.05
R6076:Cep70 UTSW 9 99298505 missense probably damaging 1.00
R6848:Cep70 UTSW 9 99262901 missense probably benign 0.34
R6977:Cep70 UTSW 9 99291676 missense probably damaging 1.00
R7286:Cep70 UTSW 9 99275585 missense probably damaging 1.00
R7437:Cep70 UTSW 9 99291529 missense probably damaging 1.00
R7754:Cep70 UTSW 9 99281092 missense probably damaging 1.00
R7879:Cep70 UTSW 9 99262633 missense possibly damaging 0.54
R7962:Cep70 UTSW 9 99262633 missense possibly damaging 0.54
R8063:Cep70 UTSW 9 99296122 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- TACATGCAGAGACGCACATG -3'
(R):5'- CCATCAACGTTTTCAAAATCTGCC -3'

Sequencing Primer
(F):5'- ACATCTAGAAATCGAAAGTCCTGG -3'
(R):5'- TATGCTTACACACACATACACGAGAG -3'
Posted On2015-04-30