Incidental Mutation 'R0388:Synpo2'
ID 31400
Institutional Source Beutler Lab
Gene Symbol Synpo2
Ensembl Gene ENSMUSG00000050315
Gene Name synaptopodin 2
Synonyms 1110069I04Rik, Myo, 9530006G20Rik, 2310068J10Rik, myopodin
MMRRC Submission 038594-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R0388 (G1)
Quality Score 225
Status Validated
Chromosome 3
Chromosomal Location 123076519-123236149 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 123079897 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 1140 (V1140A)
Ref Sequence ENSEMBL: ENSMUSP00000102035 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000106426] [ENSMUST00000106427]
AlphaFold Q91YE8
Predicted Effect probably benign
Transcript: ENSMUST00000106426
AA Change: V1199A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000102034
Gene: ENSMUSG00000050315
AA Change: V1199A

DomainStartEndE-ValueType
PDZ 15 88 6.51e-14 SMART
low complexity region 339 357 N/A INTRINSIC
internal_repeat_2 377 398 4.61e-5 PROSPERO
low complexity region 406 424 N/A INTRINSIC
low complexity region 434 448 N/A INTRINSIC
internal_repeat_1 477 503 2.92e-7 PROSPERO
internal_repeat_2 478 499 4.61e-5 PROSPERO
low complexity region 534 549 N/A INTRINSIC
low complexity region 609 621 N/A INTRINSIC
low complexity region 628 651 N/A INTRINSIC
low complexity region 740 777 N/A INTRINSIC
low complexity region 802 814 N/A INTRINSIC
low complexity region 846 854 N/A INTRINSIC
internal_repeat_1 858 884 2.92e-7 PROSPERO
low complexity region 941 950 N/A INTRINSIC
low complexity region 1034 1051 N/A INTRINSIC
low complexity region 1196 1211 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000106427
AA Change: V1140A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000102035
Gene: ENSMUSG00000050315
AA Change: V1140A

DomainStartEndE-ValueType
PDZ 15 88 6.51e-14 SMART
low complexity region 339 357 N/A INTRINSIC
internal_repeat_2 377 398 6.19e-5 PROSPERO
low complexity region 406 424 N/A INTRINSIC
low complexity region 434 448 N/A INTRINSIC
internal_repeat_1 477 503 4.33e-7 PROSPERO
internal_repeat_2 478 499 6.19e-5 PROSPERO
low complexity region 534 549 N/A INTRINSIC
low complexity region 609 621 N/A INTRINSIC
low complexity region 628 651 N/A INTRINSIC
low complexity region 740 777 N/A INTRINSIC
low complexity region 802 814 N/A INTRINSIC
low complexity region 846 854 N/A INTRINSIC
internal_repeat_1 858 884 4.33e-7 PROSPERO
low complexity region 941 950 N/A INTRINSIC
low complexity region 1137 1152 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000139160
AA Change: V157A
SMART Domains Protein: ENSMUSP00000123396
Gene: ENSMUSG00000050315
AA Change: V157A

DomainStartEndE-ValueType
low complexity region 155 170 N/A INTRINSIC
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.0%
  • 10x: 95.6%
  • 20x: 90.7%
Validation Efficiency 100% (67/67)
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010315B03Rik T C 9: 124,295,159 probably benign Het
Acsbg1 T C 9: 54,609,063 K678R probably damaging Het
Adgrg6 A G 10: 14,450,658 I410T probably benign Het
Afap1l2 A C 19: 56,917,242 probably benign Het
Aox2 T C 1: 58,354,406 Y1242H probably damaging Het
Apoo-ps T C 13: 107,414,673 noncoding transcript Het
Camta1 C A 4: 151,075,140 R1614L probably damaging Het
Cdh3 C A 8: 106,539,129 T268K probably damaging Het
Chd5 T A 4: 152,371,644 H923Q probably damaging Het
Chd7 T C 4: 8,854,560 V1967A probably benign Het
Cntn3 T C 6: 102,277,316 M222V probably damaging Het
Dcaf17 A G 2: 71,078,571 K277R probably benign Het
Dmbt1 T C 7: 131,096,049 probably benign Het
Dmpk T A 7: 19,084,077 probably benign Het
Dzank1 A T 2: 144,476,106 L714Q possibly damaging Het
Efcab3 A G 11: 105,109,401 D272G possibly damaging Het
Erbb2 G C 11: 98,427,351 R471P possibly damaging Het
Esf1 T A 2: 140,120,871 Y760F possibly damaging Het
Fanci C A 7: 79,439,630 T938K probably benign Het
Gnai3 A G 3: 108,115,757 probably benign Het
Hspg2 T A 4: 137,511,158 C319S probably damaging Het
Il12a T A 3: 68,695,187 probably null Het
Inpp4a A G 1: 37,396,160 D837G probably damaging Het
Kcnj5 T A 9: 32,317,863 E13V probably damaging Het
Kcnq3 T A 15: 66,000,038 Y594F probably benign Het
Kif16b T C 2: 142,740,937 E556G probably damaging Het
Kif28 T C 1: 179,740,089 I39V possibly damaging Het
Lgi2 T C 5: 52,554,549 E143G probably damaging Het
Mast1 T G 8: 84,915,537 I1063L probably benign Het
Med12l T C 3: 59,093,504 probably benign Het
Mmp19 G T 10: 128,798,883 R456L probably benign Het
Mon1b T A 8: 113,639,078 V346E probably damaging Het
Mpv17l A T 16: 13,940,999 I96L probably benign Het
Mrgpra9 A T 7: 47,252,794 M1K probably null Het
Mycbp2 A T 14: 103,156,667 H2819Q probably benign Het
Nav1 A C 1: 135,448,917 probably benign Het
Neurl4 T C 11: 69,911,733 probably benign Het
Ntng2 G C 2: 29,207,426 P341R probably damaging Het
Oas1d A T 5: 120,917,028 Y221F probably damaging Het
Olfr1040 A G 2: 86,146,630 Y35H probably damaging Het
Olfr348 C A 2: 36,786,862 D112E probably benign Het
Olfr365 A C 2: 37,202,184 probably null Het
Osbpl8 A G 10: 111,272,282 M380V probably benign Het
Pank1 T C 19: 34,821,706 probably benign Het
Parn T C 16: 13,654,476 D169G possibly damaging Het
Pknox1 T A 17: 31,603,192 I311N probably damaging Het
Pprc1 T C 19: 46,062,775 V248A possibly damaging Het
Prkcq T C 2: 11,254,234 C322R probably benign Het
Ptpn13 T A 5: 103,555,062 I1298N probably benign Het
Rab11fip3 A G 17: 26,069,072 S36P probably benign Het
Rif1 GCCACCA GCCA 2: 52,110,324 probably benign Het
Sass6 C A 3: 116,607,308 probably benign Het
Shroom3 G A 5: 92,951,293 G1463D probably benign Het
Slc35d1 A T 4: 103,184,887 Y249* probably null Het
Slc9a3 C T 13: 74,121,536 P8S unknown Het
Slc9a9 T A 9: 94,939,563 probably null Het
Syne2 T A 12: 75,986,975 M3666K probably benign Het
Thada A G 17: 84,231,096 F1495L probably benign Het
Timeless A G 10: 128,241,425 probably null Het
Tlr6 G T 5: 64,955,205 H120N possibly damaging Het
Tmem173 A G 18: 35,735,111 probably null Het
Tns3 T C 11: 8,445,703 I1234V probably benign Het
Ttll9 A G 2: 153,000,179 S318G probably benign Het
Vps13c T C 9: 67,922,915 probably benign Het
Zfp933 T C 4: 147,826,442 I232M probably benign Het
Zfyve27 T C 19: 42,189,585 S382P probably damaging Het
Other mutations in Synpo2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00333:Synpo2 APN 3 123113210 missense probably damaging 1.00
IGL00742:Synpo2 APN 3 123113876 missense probably damaging 1.00
IGL01890:Synpo2 APN 3 123112497 missense probably damaging 1.00
IGL02268:Synpo2 APN 3 123116983 missense probably damaging 1.00
IGL02323:Synpo2 APN 3 123117534 missense probably benign 0.00
IGL02745:Synpo2 APN 3 123113612 missense probably damaging 1.00
IGL03001:Synpo2 APN 3 123079955 missense probably benign 0.00
IGL03177:Synpo2 APN 3 123121215 missense probably damaging 1.00
IGL03336:Synpo2 APN 3 123114179 missense possibly damaging 0.60
R0086:Synpo2 UTSW 3 123117104 nonsense probably null
R0126:Synpo2 UTSW 3 123079862 missense possibly damaging 0.71
R0227:Synpo2 UTSW 3 123113793 missense probably benign 0.02
R0284:Synpo2 UTSW 3 123079734 nonsense probably null
R0457:Synpo2 UTSW 3 123112772 missense probably damaging 1.00
R0483:Synpo2 UTSW 3 123114332 missense probably damaging 1.00
R0615:Synpo2 UTSW 3 123117287 missense probably damaging 1.00
R0646:Synpo2 UTSW 3 123114449 missense probably damaging 1.00
R0666:Synpo2 UTSW 3 123114059 missense probably damaging 0.98
R0743:Synpo2 UTSW 3 123112706 missense probably benign 0.02
R0791:Synpo2 UTSW 3 123113186 missense probably benign
R1531:Synpo2 UTSW 3 123117666 missense probably benign 0.03
R1587:Synpo2 UTSW 3 123114398 missense probably damaging 0.98
R1717:Synpo2 UTSW 3 123112554 missense probably damaging 1.00
R1807:Synpo2 UTSW 3 123080257 missense possibly damaging 0.71
R2114:Synpo2 UTSW 3 123079888 missense probably benign 0.01
R2987:Synpo2 UTSW 3 123116973 missense probably damaging 1.00
R3019:Synpo2 UTSW 3 123113579 missense probably damaging 1.00
R3939:Synpo2 UTSW 3 123114590 missense probably damaging 1.00
R4050:Synpo2 UTSW 3 123114278 missense possibly damaging 0.81
R4119:Synpo2 UTSW 3 123117150 missense probably damaging 1.00
R4669:Synpo2 UTSW 3 123113063 missense probably damaging 1.00
R4724:Synpo2 UTSW 3 123114291 missense probably damaging 1.00
R4825:Synpo2 UTSW 3 123114419 missense probably damaging 0.98
R5152:Synpo2 UTSW 3 123235901 critical splice donor site probably null
R5292:Synpo2 UTSW 3 123114060 missense possibly damaging 0.51
R5396:Synpo2 UTSW 3 123117682 nonsense probably null
R5701:Synpo2 UTSW 3 123080230 missense probably damaging 1.00
R5712:Synpo2 UTSW 3 123121210 missense probably damaging 1.00
R5730:Synpo2 UTSW 3 123114119 missense probably benign 0.04
R5879:Synpo2 UTSW 3 123114297 missense probably damaging 1.00
R5979:Synpo2 UTSW 3 123117411 missense probably damaging 1.00
R6290:Synpo2 UTSW 3 123117052 missense probably damaging 0.98
R6384:Synpo2 UTSW 3 123113049 nonsense probably null
R6498:Synpo2 UTSW 3 123080232 splice site probably null
R7123:Synpo2 UTSW 3 123113186 missense probably benign
R7153:Synpo2 UTSW 3 123112404 makesense probably null
R7233:Synpo2 UTSW 3 123117684 missense probably benign 0.01
R7301:Synpo2 UTSW 3 123114053 missense probably benign 0.10
R7318:Synpo2 UTSW 3 123117319 missense probably benign
R7366:Synpo2 UTSW 3 123114041 missense probably damaging 0.96
R7630:Synpo2 UTSW 3 123080032 missense probably damaging 1.00
R7962:Synpo2 UTSW 3 123235986 missense probably benign 0.09
R8068:Synpo2 UTSW 3 123117392 missense possibly damaging 0.59
R8335:Synpo2 UTSW 3 123114534 missense probably damaging 1.00
R9066:Synpo2 UTSW 3 123117484 missense possibly damaging 0.66
R9269:Synpo2 UTSW 3 123117324 missense probably benign 0.00
R9318:Synpo2 UTSW 3 123080056 missense probably damaging 1.00
R9623:Synpo2 UTSW 3 123114398 missense possibly damaging 0.68
R9685:Synpo2 UTSW 3 123117717 missense probably damaging 1.00
Z1177:Synpo2 UTSW 3 123113010 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGCAGTTCCTTAGGCATTGGCAG -3'
(R):5'- CAGGAATCCATCGTGGCACATGTAG -3'

Sequencing Primer
(F):5'- ACACAAGCTTTCACGGTTGTTG -3'
(R):5'- ACATGTAGTCTCCGCAGC -3'
Posted On 2013-04-24