Incidental Mutation 'R4044:Grid1'
ID314001
Institutional Source Beutler Lab
Gene Symbol Grid1
Ensembl Gene ENSMUSG00000041078
Gene Nameglutamate receptor, ionotropic, delta 1
SynonymsGluRdelta1
MMRRC Submission 040967-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.069) question?
Stock #R4044 (G1)
Quality Score225
Status Validated
Chromosome14
Chromosomal Location34820108-35583379 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) A to T at 35450401 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000044009 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043349]
Predicted Effect probably benign
Transcript: ENSMUST00000043349
SMART Domains Protein: ENSMUSP00000044009
Gene: ENSMUSG00000041078

DomainStartEndE-ValueType
Pfam:ANF_receptor 36 400 4.1e-51 PFAM
PBPe 438 807 4.68e-110 SMART
Lig_chan-Glu_bd 448 510 8.18e-25 SMART
low complexity region 838 853 N/A INTRINSIC
low complexity region 943 958 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000227253
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.5%
Validation Efficiency 100% (45/45)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a subunit of glutamate receptor channels. These channels mediate most of the fast excitatory synaptic transmission in the central nervous system and play key roles in synaptic plasticity.[provided by RefSeq, Jan 2009]
PHENOTYPE: Homozygotes for a targeted null mutation display a significant high-frequency hearing loss, associated with reductions of both cochlear outer hair cell function and endolymphatic potential, as well as increased vulnerability to acoustic injury. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4430402I18Rik A T 19: 28,945,783 C80S possibly damaging Het
4930579C12Rik T A 9: 89,162,294 noncoding transcript Het
9130011E15Rik A T 19: 45,820,324 Y643N probably damaging Het
Ada A T 2: 163,735,460 I36N probably damaging Het
Atg7 T C 6: 114,701,978 V384A probably benign Het
Ccl1 T A 11: 82,179,693 I18L probably benign Het
Cep70 T A 9: 99,262,609 C66S possibly damaging Het
D16Ertd472e A T 16: 78,576,006 D14E probably damaging Het
D330045A20Rik C T X: 139,507,003 S364L probably damaging Het
D430042O09Rik A G 7: 125,868,741 I1366V probably benign Het
Dnah9 T C 11: 66,133,635 K278E probably benign Het
Dsg1a C A 18: 20,324,030 N153K probably damaging Het
Galnt5 T A 2: 57,998,460 I24N probably damaging Het
Gm13084 T A 4: 143,811,600 N267I probably benign Het
Gtf2a1 T C 12: 91,575,667 H47R probably benign Het
Igf1r A G 7: 68,190,062 T706A possibly damaging Het
Itih4 A T 14: 30,895,038 N517I probably damaging Het
Jam3 C A 9: 27,101,863 probably null Het
Klk1b4 A G 7: 44,210,755 M98V probably benign Het
Kndc1 A G 7: 139,924,129 E1116G probably benign Het
Ksr2 C T 5: 117,555,062 R192* probably null Het
L3mbtl4 T C 17: 68,777,914 S607P possibly damaging Het
Map6 T C 7: 99,268,049 C10R probably damaging Het
Mpp5 G A 12: 78,824,839 E398K probably benign Het
Myo3a A G 2: 22,577,700 E322G probably damaging Het
Nell1 A G 7: 50,219,619 N214S probably damaging Het
Npm3 T C 19: 45,748,253 E149G possibly damaging Het
Olfr1277 C T 2: 111,269,582 V262I probably benign Het
Olfr192 G A 16: 59,098,761 T77I unknown Het
Orc3 G A 4: 34,587,055 Q345* probably null Het
Otol1 A G 3: 70,027,779 D368G probably damaging Het
Prss40 G T 1: 34,560,879 S9* probably null Het
Reln A T 5: 22,128,632 V264D possibly damaging Het
Rpp40 A G 13: 35,898,566 C275R probably benign Het
Scaf1 G A 7: 45,006,374 probably benign Het
Sncaip A G 18: 52,907,403 T890A probably benign Het
Sssca1 T C 19: 5,730,403 E189G probably damaging Het
Thada A G 17: 84,441,707 V612A probably benign Het
Tsnaxip1 G A 8: 105,833,545 probably null Het
Vcan T A 13: 89,692,543 L1627F probably benign Het
Vrtn T C 12: 84,649,070 I198T probably damaging Het
Wnt9b T C 11: 103,731,998 D193G probably damaging Het
Zswim5 A G 4: 116,986,702 D979G probably damaging Het
Other mutations in Grid1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00705:Grid1 APN 14 35445887 missense possibly damaging 0.70
IGL01016:Grid1 APN 14 34822639 nonsense probably null
IGL01643:Grid1 APN 14 35323435 critical splice donor site probably null
IGL01697:Grid1 APN 14 35309257 missense probably benign 0.21
IGL01879:Grid1 APN 14 35450370 missense possibly damaging 0.93
IGL01975:Grid1 APN 14 35323426 missense probably benign
IGL02515:Grid1 APN 14 35452345 missense probably damaging 0.99
IGL02935:Grid1 APN 14 34822558 missense possibly damaging 0.86
IGL03279:Grid1 APN 14 34945765 missense probably damaging 0.98
IGL03286:Grid1 APN 14 35520685 splice site probably benign
IGL03296:Grid1 APN 14 35580567 missense possibly damaging 0.52
IGL03305:Grid1 APN 14 35251707 missense probably damaging 1.00
R0533:Grid1 UTSW 14 35309385 missense possibly damaging 0.84
R0746:Grid1 UTSW 14 34822690 missense possibly damaging 0.92
R0811:Grid1 UTSW 14 34822619 missense probably benign
R0812:Grid1 UTSW 14 34822619 missense probably benign
R1144:Grid1 UTSW 14 35562676 splice site probably benign
R1217:Grid1 UTSW 14 34820229 start codon destroyed probably null 0.53
R1485:Grid1 UTSW 14 34822583 missense probably damaging 1.00
R1529:Grid1 UTSW 14 35309293 missense probably benign 0.36
R1606:Grid1 UTSW 14 35445965 missense probably damaging 0.96
R1691:Grid1 UTSW 14 35452329 missense probably damaging 1.00
R1759:Grid1 UTSW 14 35446031 missense possibly damaging 0.92
R2374:Grid1 UTSW 14 35321807 splice site probably benign
R2415:Grid1 UTSW 14 35450369 missense possibly damaging 0.69
R2866:Grid1 UTSW 14 35562559 missense probably damaging 1.00
R3915:Grid1 UTSW 14 35520727 missense probably damaging 1.00
R4364:Grid1 UTSW 14 34946032 missense probably benign 0.20
R4691:Grid1 UTSW 14 35569557 missense probably benign
R4694:Grid1 UTSW 14 35026780 missense probably damaging 1.00
R4749:Grid1 UTSW 14 35580687 missense possibly damaging 0.50
R4794:Grid1 UTSW 14 34822622 missense probably damaging 0.99
R4854:Grid1 UTSW 14 35321641 missense probably benign
R5555:Grid1 UTSW 14 35520705 missense possibly damaging 0.92
R6005:Grid1 UTSW 14 35323412 missense probably damaging 1.00
R6176:Grid1 UTSW 14 35562547 missense probably benign 0.00
R6569:Grid1 UTSW 14 35323339 missense possibly damaging 0.72
R6911:Grid1 UTSW 14 34820228 start codon destroyed probably benign 0.08
R7504:Grid1 UTSW 14 35562513 missense probably damaging 1.00
R7744:Grid1 UTSW 14 35450079 missense probably damaging 1.00
R7795:Grid1 UTSW 14 35321685 missense probably damaging 1.00
R7883:Grid1 UTSW 14 35450302 splice site probably null
R7913:Grid1 UTSW 14 35569697 missense probably damaging 0.99
R8032:Grid1 UTSW 14 35323359 missense probably benign 0.00
R8333:Grid1 UTSW 14 35569638 missense possibly damaging 0.82
U24488:Grid1 UTSW 14 35580577 missense probably benign 0.00
Z1088:Grid1 UTSW 14 35452294 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCTCATCAAGAAGCCTGAGG -3'
(R):5'- AGCCATCACTCTAACGTGGG -3'

Sequencing Primer
(F):5'- CCTGAGGAGAAGATCAGCATC -3'
(R):5'- CATCACTCTAACGTGGGAGGGG -3'
Posted On2015-04-30