Incidental Mutation 'R0388:Chd7'
ID 31401
Institutional Source Beutler Lab
Gene Symbol Chd7
Ensembl Gene ENSMUSG00000041235
Gene Name chromodomain helicase DNA binding protein 7
Synonyms A730019I05Rik, Cycn, Cyn, Dz, Edy, Flo, GENA 47, Gena 52, GENA 60, Lda, Mt, Obt, Todo, WBE1, Whi
MMRRC Submission 038594-MU
Accession Numbers

Genbank: NM_001081417; MGI: 2444748

Essential gene? Probably essential (E-score: 0.946) question?
Stock # R0388 (G1)
Quality Score 225
Status Validated
Chromosome 4
Chromosomal Location 8690406-8867659 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 8854560 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 1967 (V1967A)
Ref Sequence ENSEMBL: ENSMUSP00000059079 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039267] [ENSMUST00000051558] [ENSMUST00000170391]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000039267
AA Change: V1967A

PolyPhen 2 Score 0.269 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000043903
Gene: ENSMUSG00000041235
AA Change: V1967A

DomainStartEndE-ValueType
low complexity region 11 28 N/A INTRINSIC
low complexity region 48 59 N/A INTRINSIC
low complexity region 107 129 N/A INTRINSIC
low complexity region 152 178 N/A INTRINSIC
low complexity region 194 206 N/A INTRINSIC
low complexity region 385 400 N/A INTRINSIC
low complexity region 491 504 N/A INTRINSIC
low complexity region 512 535 N/A INTRINSIC
low complexity region 585 595 N/A INTRINSIC
low complexity region 632 696 N/A INTRINSIC
low complexity region 721 733 N/A INTRINSIC
low complexity region 735 748 N/A INTRINSIC
low complexity region 759 768 N/A INTRINSIC
CHROMO 789 854 2.54e-9 SMART
CHROMO 870 927 2.94e-5 SMART
low complexity region 928 939 N/A INTRINSIC
DEXDc 954 1155 9.64e-38 SMART
HELICc 1310 1394 1.67e-23 SMART
Blast:DEXDc 1608 1653 8e-16 BLAST
low complexity region 1728 1739 N/A INTRINSIC
internal_repeat_2 1774 1825 1.31e-5 PROSPERO
low complexity region 1831 1846 N/A INTRINSIC
low complexity region 1898 1906 N/A INTRINSIC
low complexity region 1929 1947 N/A INTRINSIC
SANT 1952 2011 9.31e-1 SMART
internal_repeat_2 2079 2126 1.31e-5 PROSPERO
low complexity region 2173 2195 N/A INTRINSIC
low complexity region 2218 2244 N/A INTRINSIC
low complexity region 2387 2407 N/A INTRINSIC
low complexity region 2437 2452 N/A INTRINSIC
BRK 2553 2602 6.57e-23 SMART
BRK 2631 2675 3.77e-23 SMART
low complexity region 2715 2725 N/A INTRINSIC
low complexity region 2746 2758 N/A INTRINSIC
low complexity region 2769 2778 N/A INTRINSIC
low complexity region 2785 2796 N/A INTRINSIC
low complexity region 2810 2821 N/A INTRINSIC
low complexity region 2897 2916 N/A INTRINSIC
low complexity region 2967 2980 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000051558
AA Change: V1967A

PolyPhen 2 Score 0.269 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000059079
Gene: ENSMUSG00000041235
AA Change: V1967A

DomainStartEndE-ValueType
low complexity region 11 28 N/A INTRINSIC
low complexity region 48 59 N/A INTRINSIC
low complexity region 107 129 N/A INTRINSIC
low complexity region 152 178 N/A INTRINSIC
low complexity region 194 206 N/A INTRINSIC
low complexity region 385 400 N/A INTRINSIC
low complexity region 491 504 N/A INTRINSIC
low complexity region 512 535 N/A INTRINSIC
low complexity region 585 595 N/A INTRINSIC
low complexity region 632 696 N/A INTRINSIC
low complexity region 721 733 N/A INTRINSIC
low complexity region 735 748 N/A INTRINSIC
low complexity region 759 768 N/A INTRINSIC
CHROMO 789 854 2.54e-9 SMART
CHROMO 870 927 2.94e-5 SMART
low complexity region 928 939 N/A INTRINSIC
DEXDc 954 1155 9.64e-38 SMART
HELICc 1310 1394 1.67e-23 SMART
Blast:DEXDc 1608 1653 8e-16 BLAST
low complexity region 1728 1739 N/A INTRINSIC
internal_repeat_2 1774 1825 1.31e-5 PROSPERO
low complexity region 1831 1846 N/A INTRINSIC
low complexity region 1898 1906 N/A INTRINSIC
low complexity region 1929 1947 N/A INTRINSIC
SANT 1952 2011 9.31e-1 SMART
internal_repeat_2 2079 2126 1.31e-5 PROSPERO
low complexity region 2173 2195 N/A INTRINSIC
low complexity region 2218 2244 N/A INTRINSIC
low complexity region 2387 2407 N/A INTRINSIC
low complexity region 2437 2452 N/A INTRINSIC
BRK 2553 2602 6.57e-23 SMART
BRK 2631 2675 3.77e-23 SMART
low complexity region 2715 2725 N/A INTRINSIC
low complexity region 2746 2758 N/A INTRINSIC
low complexity region 2769 2778 N/A INTRINSIC
low complexity region 2785 2796 N/A INTRINSIC
low complexity region 2810 2821 N/A INTRINSIC
low complexity region 2897 2916 N/A INTRINSIC
low complexity region 2967 2980 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000170391
SMART Domains Protein: ENSMUSP00000127007
Gene: ENSMUSG00000041235

DomainStartEndE-ValueType
low complexity region 11 28 N/A INTRINSIC
low complexity region 48 59 N/A INTRINSIC
low complexity region 107 129 N/A INTRINSIC
low complexity region 152 178 N/A INTRINSIC
low complexity region 194 206 N/A INTRINSIC
low complexity region 385 400 N/A INTRINSIC
low complexity region 491 504 N/A INTRINSIC
low complexity region 512 535 N/A INTRINSIC
BRK 586 630 3.77e-23 SMART
low complexity region 670 680 N/A INTRINSIC
low complexity region 701 713 N/A INTRINSIC
low complexity region 724 733 N/A INTRINSIC
low complexity region 740 751 N/A INTRINSIC
low complexity region 765 776 N/A INTRINSIC
low complexity region 852 871 N/A INTRINSIC
low complexity region 922 935 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000222546
Meta Mutation Damage Score 0.2950 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.0%
  • 10x: 95.6%
  • 20x: 90.7%
Validation Efficiency 100% (67/67)
MGI Phenotype FUNCTION: This gene encodes a protein containing two chromodomains and an ATP-binding helicase domain that functions as a regulator of transcription. Mutations in this gene result in an array of development defects, including inner ear problems. Mice defective for this gene exhibit many of the clinical features of the CHARGE syndrome caused by mutations in the homologous gene in human. [provided by RefSeq, Sep 2015]
PHENOTYPE: Heterozygotes for mutations of this gene exhibit a variety of combinations of hyperactivity, circling, head-bobbing, semicircular canal defects, hearing loss, reduced size, and tail-kink. [provided by MGI curators]
Allele List at MGI

All alleles(32) : Targeted, other(4) Gene trapped(19) Chemically induced(9)

Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010315B03Rik T C 9: 124,295,159 probably benign Het
Acsbg1 T C 9: 54,609,063 K678R probably damaging Het
Adgrg6 A G 10: 14,450,658 I410T probably benign Het
Afap1l2 A C 19: 56,917,242 probably benign Het
Aox2 T C 1: 58,354,406 Y1242H probably damaging Het
Apoo-ps T C 13: 107,414,673 noncoding transcript Het
Camta1 C A 4: 151,075,140 R1614L probably damaging Het
Cdh3 C A 8: 106,539,129 T268K probably damaging Het
Chd5 T A 4: 152,371,644 H923Q probably damaging Het
Cntn3 T C 6: 102,277,316 M222V probably damaging Het
Dcaf17 A G 2: 71,078,571 K277R probably benign Het
Dmbt1 T C 7: 131,096,049 probably benign Het
Dmpk T A 7: 19,084,077 probably benign Het
Dzank1 A T 2: 144,476,106 L714Q possibly damaging Het
Efcab3 A G 11: 105,109,401 D272G possibly damaging Het
Erbb2 G C 11: 98,427,351 R471P possibly damaging Het
Esf1 T A 2: 140,120,871 Y760F possibly damaging Het
Fanci C A 7: 79,439,630 T938K probably benign Het
Gnai3 A G 3: 108,115,757 probably benign Het
Hspg2 T A 4: 137,511,158 C319S probably damaging Het
Il12a T A 3: 68,695,187 probably null Het
Inpp4a A G 1: 37,396,160 D837G probably damaging Het
Kcnj5 T A 9: 32,317,863 E13V probably damaging Het
Kcnq3 T A 15: 66,000,038 Y594F probably benign Het
Kif16b T C 2: 142,740,937 E556G probably damaging Het
Kif28 T C 1: 179,740,089 I39V possibly damaging Het
Lgi2 T C 5: 52,554,549 E143G probably damaging Het
Mast1 T G 8: 84,915,537 I1063L probably benign Het
Med12l T C 3: 59,093,504 probably benign Het
Mmp19 G T 10: 128,798,883 R456L probably benign Het
Mon1b T A 8: 113,639,078 V346E probably damaging Het
Mpv17l A T 16: 13,940,999 I96L probably benign Het
Mrgpra9 A T 7: 47,252,794 M1K probably null Het
Mycbp2 A T 14: 103,156,667 H2819Q probably benign Het
Nav1 A C 1: 135,448,917 probably benign Het
Neurl4 T C 11: 69,911,733 probably benign Het
Ntng2 G C 2: 29,207,426 P341R probably damaging Het
Oas1d A T 5: 120,917,028 Y221F probably damaging Het
Olfr1040 A G 2: 86,146,630 Y35H probably damaging Het
Olfr348 C A 2: 36,786,862 D112E probably benign Het
Olfr365 A C 2: 37,202,184 probably null Het
Osbpl8 A G 10: 111,272,282 M380V probably benign Het
Pank1 T C 19: 34,821,706 probably benign Het
Parn T C 16: 13,654,476 D169G possibly damaging Het
Pknox1 T A 17: 31,603,192 I311N probably damaging Het
Pprc1 T C 19: 46,062,775 V248A possibly damaging Het
Prkcq T C 2: 11,254,234 C322R probably benign Het
Ptpn13 T A 5: 103,555,062 I1298N probably benign Het
Rab11fip3 A G 17: 26,069,072 S36P probably benign Het
Rif1 GCCACCA GCCA 2: 52,110,324 probably benign Het
Sass6 C A 3: 116,607,308 probably benign Het
Shroom3 G A 5: 92,951,293 G1463D probably benign Het
Slc35d1 A T 4: 103,184,887 Y249* probably null Het
Slc9a3 C T 13: 74,121,536 P8S unknown Het
Slc9a9 T A 9: 94,939,563 probably null Het
Syne2 T A 12: 75,986,975 M3666K probably benign Het
Synpo2 A G 3: 123,079,897 V1140A probably benign Het
Thada A G 17: 84,231,096 F1495L probably benign Het
Timeless A G 10: 128,241,425 probably null Het
Tlr6 G T 5: 64,955,205 H120N possibly damaging Het
Tmem173 A G 18: 35,735,111 probably null Het
Tns3 T C 11: 8,445,703 I1234V probably benign Het
Ttll9 A G 2: 153,000,179 S318G probably benign Het
Vps13c T C 9: 67,922,915 probably benign Het
Zfp933 T C 4: 147,826,442 I232M probably benign Het
Zfyve27 T C 19: 42,189,585 S382P probably damaging Het
Other mutations in Chd7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00422:Chd7 APN 4 8859106 missense probably damaging 1.00
IGL00510:Chd7 APN 4 8801404 missense probably damaging 1.00
IGL00741:Chd7 APN 4 8839454 missense probably damaging 1.00
IGL00796:Chd7 APN 4 8847271 missense possibly damaging 0.95
IGL00907:Chd7 APN 4 8840435 missense probably damaging 0.98
IGL00930:Chd7 APN 4 8805181 missense probably damaging 1.00
IGL01542:Chd7 APN 4 8859285 missense possibly damaging 0.71
IGL01602:Chd7 APN 4 8833834 missense probably damaging 1.00
IGL01605:Chd7 APN 4 8833834 missense probably damaging 1.00
IGL01670:Chd7 APN 4 8827033 missense probably damaging 0.98
IGL02434:Chd7 APN 4 8752145 missense probably benign 0.00
IGL02531:Chd7 APN 4 8854134 missense probably damaging 1.00
IGL02626:Chd7 APN 4 8826519 missense probably damaging 1.00
IGL02961:Chd7 APN 4 8751542 missense probably damaging 1.00
IGL02972:Chd7 APN 4 8855174 missense probably benign 0.30
IGL03329:Chd7 APN 4 8841108 missense probably damaging 1.00
Fili UTSW 4 8839523 missense probably damaging 1.00
D4043:Chd7 UTSW 4 8862650 missense probably damaging 1.00
IGL02991:Chd7 UTSW 4 8828398 missense possibly damaging 0.91
PIT4466001:Chd7 UTSW 4 8753101 missense unknown
PIT4472001:Chd7 UTSW 4 8753101 missense unknown
R0157:Chd7 UTSW 4 8833759 missense probably damaging 1.00
R0179:Chd7 UTSW 4 8862516 missense probably benign 0.22
R0240:Chd7 UTSW 4 8852670 unclassified probably benign
R0462:Chd7 UTSW 4 8850821 missense probably damaging 1.00
R0512:Chd7 UTSW 4 8805139 intron probably benign
R0657:Chd7 UTSW 4 8753141 missense probably damaging 1.00
R0799:Chd7 UTSW 4 8801310 intron probably benign
R0885:Chd7 UTSW 4 8866432 missense probably damaging 1.00
R1056:Chd7 UTSW 4 8822402 missense possibly damaging 0.50
R1086:Chd7 UTSW 4 8866458 missense probably benign 0.04
R1353:Chd7 UTSW 4 8839556 missense probably damaging 0.99
R1466:Chd7 UTSW 4 8840561 splice site probably null
R1466:Chd7 UTSW 4 8840561 splice site probably null
R1605:Chd7 UTSW 4 8844675 missense probably damaging 1.00
R1693:Chd7 UTSW 4 8864307 critical splice donor site probably null
R1695:Chd7 UTSW 4 8833960 missense probably damaging 1.00
R1938:Chd7 UTSW 4 8847200 missense probably damaging 1.00
R1964:Chd7 UTSW 4 8865978 missense probably damaging 0.96
R2020:Chd7 UTSW 4 8855226 missense probably benign 0.00
R2134:Chd7 UTSW 4 8753147 missense probably damaging 0.99
R2171:Chd7 UTSW 4 8752424 missense probably damaging 1.00
R2271:Chd7 UTSW 4 8785532 missense probably damaging 1.00
R2300:Chd7 UTSW 4 8855241 missense probably benign 0.02
R2355:Chd7 UTSW 4 8801350 missense possibly damaging 0.95
R3153:Chd7 UTSW 4 8855174 missense probably benign 0.30
R3430:Chd7 UTSW 4 8844517 missense probably damaging 0.99
R3746:Chd7 UTSW 4 8752537 missense probably damaging 1.00
R4118:Chd7 UTSW 4 8865831 missense probably damaging 1.00
R4119:Chd7 UTSW 4 8785658 intron probably benign
R4332:Chd7 UTSW 4 8854143 missense probably damaging 1.00
R4402:Chd7 UTSW 4 8866353 missense possibly damaging 0.61
R4571:Chd7 UTSW 4 8866217 missense probably benign 0.09
R4722:Chd7 UTSW 4 8822445 missense probably damaging 1.00
R4821:Chd7 UTSW 4 8844706 missense probably damaging 1.00
R4894:Chd7 UTSW 4 8838629 missense probably damaging 0.99
R5205:Chd7 UTSW 4 8752509 missense possibly damaging 0.60
R5344:Chd7 UTSW 4 8844417 missense probably damaging 1.00
R5484:Chd7 UTSW 4 8828258 missense probably damaging 1.00
R5578:Chd7 UTSW 4 8847149 missense probably benign 0.09
R5583:Chd7 UTSW 4 8752473 missense probably damaging 1.00
R5888:Chd7 UTSW 4 8866382 missense probably damaging 0.98
R5905:Chd7 UTSW 4 8840553 missense possibly damaging 0.91
R6091:Chd7 UTSW 4 8751875 missense probably damaging 0.99
R6126:Chd7 UTSW 4 8826482 missense probably damaging 1.00
R6399:Chd7 UTSW 4 8828274 missense probably damaging 1.00
R6751:Chd7 UTSW 4 8833866 missense probably damaging 1.00
R6810:Chd7 UTSW 4 8839523 missense probably damaging 1.00
R6868:Chd7 UTSW 4 8811501 splice site probably null
R6952:Chd7 UTSW 4 8856797 missense probably damaging 1.00
R6986:Chd7 UTSW 4 8859285 missense possibly damaging 0.71
R6990:Chd7 UTSW 4 8844525 missense probably benign 0.28
R7139:Chd7 UTSW 4 8865865 missense probably benign 0.00
R7288:Chd7 UTSW 4 8847093 missense possibly damaging 0.92
R7355:Chd7 UTSW 4 8752196 missense unknown
R7452:Chd7 UTSW 4 8854731 missense probably benign 0.03
R7471:Chd7 UTSW 4 8859197 missense probably damaging 0.96
R7588:Chd7 UTSW 4 8864039 missense probably damaging 1.00
R7711:Chd7 UTSW 4 8805234 missense probably benign 0.00
R7744:Chd7 UTSW 4 8862485 splice site probably null
R7842:Chd7 UTSW 4 8854115 missense probably benign 0.01
R7883:Chd7 UTSW 4 8826504 missense probably damaging 1.00
R7934:Chd7 UTSW 4 8854121 missense probably benign 0.00
R7983:Chd7 UTSW 4 8752628 missense unknown
R7983:Chd7 UTSW 4 8844609 missense possibly damaging 0.47
R8022:Chd7 UTSW 4 8751605 missense unknown
R8161:Chd7 UTSW 4 8855038 missense probably damaging 1.00
R8274:Chd7 UTSW 4 8839432 missense probably damaging 1.00
R8278:Chd7 UTSW 4 8862485 splice site probably null
R8358:Chd7 UTSW 4 8839529 missense probably damaging 1.00
R8464:Chd7 UTSW 4 8811465 missense probably benign 0.06
R8483:Chd7 UTSW 4 8822412 missense possibly damaging 0.65
R8507:Chd7 UTSW 4 8858675 missense probably damaging 1.00
R8535:Chd7 UTSW 4 8859211 missense possibly damaging 0.92
R8695:Chd7 UTSW 4 8850812 missense probably damaging 1.00
R8700:Chd7 UTSW 4 8833892 missense probably damaging 1.00
R8755:Chd7 UTSW 4 8866069 missense probably benign 0.31
R8774:Chd7 UTSW 4 8854692 missense probably damaging 1.00
R8774-TAIL:Chd7 UTSW 4 8854692 missense probably damaging 1.00
R8796:Chd7 UTSW 4 8838691 missense probably damaging 1.00
R8992:Chd7 UTSW 4 8839589 missense probably damaging 1.00
R9018:Chd7 UTSW 4 8847083 missense possibly damaging 0.88
R9122:Chd7 UTSW 4 8840510 missense possibly damaging 0.77
R9131:Chd7 UTSW 4 8785642 missense
R9182:Chd7 UTSW 4 8838737 missense probably damaging 1.00
R9227:Chd7 UTSW 4 8805272 missense probably benign 0.03
R9254:Chd7 UTSW 4 8752210 missense unknown
R9379:Chd7 UTSW 4 8752210 missense unknown
R9388:Chd7 UTSW 4 8865756 missense possibly damaging 0.89
R9455:Chd7 UTSW 4 8752061 missense unknown
R9531:Chd7 UTSW 4 8858489 missense
R9577:Chd7 UTSW 4 8752964 missense unknown
R9634:Chd7 UTSW 4 8832499 missense probably damaging 1.00
Z1176:Chd7 UTSW 4 8844313 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTCCACTTCCTCAGGCAAGCACAG -3'
(R):5'- GCAGTGCAGCTCGTCTTTCATTCG -3'

Sequencing Primer
(F):5'- AATGCTGAGTTAGGTCAGCTCTAC -3'
(R):5'- CGTGTACCTACCGTCCTCG -3'
Posted On 2013-04-24