Mutagenetix > Incidental Mutation

Incidental Mutation 'R0388:Chd7'

31401

Institutional Source

Beutler Lab

Gene Symbol

Chd7

Ensembl Gene

ENSMUSG00000041235

Gene Name

chromodomain helicase DNA binding protein 7

Synonyms

A730019I05Rik, Cycn, Cyn, Dz, Edy, Flo, GENA 47, Gena 52, GENA 60, Lda, Mt, Obt, Todo, WBE1, Whi

MMRRC Submission

038594-MU

Accession Numbers

Genbank: NM_001081417; MGI: 2444748

Essential gene?

Probably essential (E-score: 0.946) question?

Stock #

R0388 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

8690406-8867659 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 8854560 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Alanine at position 1967 (V1967A)

Ref Sequence

ENSEMBL: ENSMUSP00000059079 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000039267] [ENSMUST00000051558] [ENSMUST00000170391]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000039267
AA Change: V1967A

PolyPhen 2 Score 0.269 (Sensitivity: 0.91; Specificity: 0.88)

SMART Domains

Protein: ENSMUSP00000043903
Gene: ENSMUSG00000041235
AA Change: V1967A

Domain	Start	End	E-Value	Type
low complexity region	11	28	N/A	INTRINSIC
low complexity region	48	59	N/A	INTRINSIC
low complexity region	107	129	N/A	INTRINSIC
low complexity region	152	178	N/A	INTRINSIC
low complexity region	194	206	N/A	INTRINSIC
low complexity region	385	400	N/A	INTRINSIC
low complexity region	491	504	N/A	INTRINSIC
low complexity region	512	535	N/A	INTRINSIC
low complexity region	585	595	N/A	INTRINSIC
low complexity region	632	696	N/A	INTRINSIC
low complexity region	721	733	N/A	INTRINSIC
low complexity region	735	748	N/A	INTRINSIC
low complexity region	759	768	N/A	INTRINSIC
CHROMO	789	854	2.54e-9	SMART
CHROMO	870	927	2.94e-5	SMART
low complexity region	928	939	N/A	INTRINSIC
DEXDc	954	1155	9.64e-38	SMART
HELICc	1310	1394	1.67e-23	SMART
Blast:DEXDc	1608	1653	8e-16	BLAST
low complexity region	1728	1739	N/A	INTRINSIC
internal_repeat_2	1774	1825	1.31e-5	PROSPERO
low complexity region	1831	1846	N/A	INTRINSIC
low complexity region	1898	1906	N/A	INTRINSIC
low complexity region	1929	1947	N/A	INTRINSIC
SANT	1952	2011	9.31e-1	SMART
internal_repeat_2	2079	2126	1.31e-5	PROSPERO
low complexity region	2173	2195	N/A	INTRINSIC
low complexity region	2218	2244	N/A	INTRINSIC
low complexity region	2387	2407	N/A	INTRINSIC
low complexity region	2437	2452	N/A	INTRINSIC
BRK	2553	2602	6.57e-23	SMART
BRK	2631	2675	3.77e-23	SMART
low complexity region	2715	2725	N/A	INTRINSIC
low complexity region	2746	2758	N/A	INTRINSIC
low complexity region	2769	2778	N/A	INTRINSIC
low complexity region	2785	2796	N/A	INTRINSIC
low complexity region	2810	2821	N/A	INTRINSIC
low complexity region	2897	2916	N/A	INTRINSIC
low complexity region	2967	2980	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000051558
AA Change: V1967A

PolyPhen 2 Score 0.269 (Sensitivity: 0.91; Specificity: 0.88)

SMART Domains

Protein: ENSMUSP00000059079
Gene: ENSMUSG00000041235
AA Change: V1967A

Domain	Start	End	E-Value	Type
low complexity region	11	28	N/A	INTRINSIC
low complexity region	48	59	N/A	INTRINSIC
low complexity region	107	129	N/A	INTRINSIC
low complexity region	152	178	N/A	INTRINSIC
low complexity region	194	206	N/A	INTRINSIC
low complexity region	385	400	N/A	INTRINSIC
low complexity region	491	504	N/A	INTRINSIC
low complexity region	512	535	N/A	INTRINSIC
low complexity region	585	595	N/A	INTRINSIC
low complexity region	632	696	N/A	INTRINSIC
low complexity region	721	733	N/A	INTRINSIC
low complexity region	735	748	N/A	INTRINSIC
low complexity region	759	768	N/A	INTRINSIC
CHROMO	789	854	2.54e-9	SMART
CHROMO	870	927	2.94e-5	SMART
low complexity region	928	939	N/A	INTRINSIC
DEXDc	954	1155	9.64e-38	SMART
HELICc	1310	1394	1.67e-23	SMART
Blast:DEXDc	1608	1653	8e-16	BLAST
low complexity region	1728	1739	N/A	INTRINSIC
internal_repeat_2	1774	1825	1.31e-5	PROSPERO
low complexity region	1831	1846	N/A	INTRINSIC
low complexity region	1898	1906	N/A	INTRINSIC
low complexity region	1929	1947	N/A	INTRINSIC
SANT	1952	2011	9.31e-1	SMART
internal_repeat_2	2079	2126	1.31e-5	PROSPERO
low complexity region	2173	2195	N/A	INTRINSIC
low complexity region	2218	2244	N/A	INTRINSIC
low complexity region	2387	2407	N/A	INTRINSIC
low complexity region	2437	2452	N/A	INTRINSIC
BRK	2553	2602	6.57e-23	SMART
BRK	2631	2675	3.77e-23	SMART
low complexity region	2715	2725	N/A	INTRINSIC
low complexity region	2746	2758	N/A	INTRINSIC
low complexity region	2769	2778	N/A	INTRINSIC
low complexity region	2785	2796	N/A	INTRINSIC
low complexity region	2810	2821	N/A	INTRINSIC
low complexity region	2897	2916	N/A	INTRINSIC
low complexity region	2967	2980	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000170391

SMART Domains

Protein: ENSMUSP00000127007
Gene: ENSMUSG00000041235

Domain	Start	End	E-Value	Type
low complexity region	11	28	N/A	INTRINSIC
low complexity region	48	59	N/A	INTRINSIC
low complexity region	107	129	N/A	INTRINSIC
low complexity region	152	178	N/A	INTRINSIC
low complexity region	194	206	N/A	INTRINSIC
low complexity region	385	400	N/A	INTRINSIC
low complexity region	491	504	N/A	INTRINSIC
low complexity region	512	535	N/A	INTRINSIC
BRK	586	630	3.77e-23	SMART
low complexity region	670	680	N/A	INTRINSIC
low complexity region	701	713	N/A	INTRINSIC
low complexity region	724	733	N/A	INTRINSIC
low complexity region	740	751	N/A	INTRINSIC
low complexity region	765	776	N/A	INTRINSIC
low complexity region	852	871	N/A	INTRINSIC
low complexity region	922	935	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000222546

Meta Mutation Damage Score

0.2950

Coding Region Coverage

1x: 99.0%
3x: 98.0%
10x: 95.6%
20x: 90.7%

Validation Efficiency

100% (67/67)

MGI Phenotype

FUNCTION: This gene encodes a protein containing two chromodomains and an ATP-binding helicase domain that functions as a regulator of transcription. Mutations in this gene result in an array of development defects, including inner ear problems. Mice defective for this gene exhibit many of the clinical features of the CHARGE syndrome caused by mutations in the homologous gene in human. [provided by RefSeq, Sep 2015]
PHENOTYPE: Heterozygotes for mutations of this gene exhibit a variety of combinations of hyperactivity, circling, head-bobbing, semicircular canal defects, hearing loss, reduced size, and tail-kink. [provided by MGI curators]

Allele List at MGI

All alleles(32) : Targeted, other(4) Gene trapped(19) Chemically induced(9)

Other mutations in this stock

Total: 66 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2010315B03Rik	T	C	9: 124,295,159		probably benign	Het
Acsbg1	T	C	9: 54,609,063	K678R	probably damaging	Het
Adgrg6	A	G	10: 14,450,658	I410T	probably benign	Het
Afap1l2	A	C	19: 56,917,242		probably benign	Het
Aox2	T	C	1: 58,354,406	Y1242H	probably damaging	Het
Apoo-ps	T	C	13: 107,414,673		noncoding transcript	Het
Camta1	C	A	4: 151,075,140	R1614L	probably damaging	Het
Cdh3	C	A	8: 106,539,129	T268K	probably damaging	Het
Chd5	T	A	4: 152,371,644	H923Q	probably damaging	Het
Cntn3	T	C	6: 102,277,316	M222V	probably damaging	Het
Dcaf17	A	G	2: 71,078,571	K277R	probably benign	Het
Dmbt1	T	C	7: 131,096,049		probably benign	Het
Dmpk	T	A	7: 19,084,077		probably benign	Het
Dzank1	A	T	2: 144,476,106	L714Q	possibly damaging	Het
Efcab3	A	G	11: 105,109,401	D272G	possibly damaging	Het
Erbb2	G	C	11: 98,427,351	R471P	possibly damaging	Het
Esf1	T	A	2: 140,120,871	Y760F	possibly damaging	Het
Fanci	C	A	7: 79,439,630	T938K	probably benign	Het
Gnai3	A	G	3: 108,115,757		probably benign	Het
Hspg2	T	A	4: 137,511,158	C319S	probably damaging	Het
Il12a	T	A	3: 68,695,187		probably null	Het
Inpp4a	A	G	1: 37,396,160	D837G	probably damaging	Het
Kcnj5	T	A	9: 32,317,863	E13V	probably damaging	Het
Kcnq3	T	A	15: 66,000,038	Y594F	probably benign	Het
Kif16b	T	C	2: 142,740,937	E556G	probably damaging	Het
Kif28	T	C	1: 179,740,089	I39V	possibly damaging	Het
Lgi2	T	C	5: 52,554,549	E143G	probably damaging	Het
Mast1	T	G	8: 84,915,537	I1063L	probably benign	Het
Med12l	T	C	3: 59,093,504		probably benign	Het
Mmp19	G	T	10: 128,798,883	R456L	probably benign	Het
Mon1b	T	A	8: 113,639,078	V346E	probably damaging	Het
Mpv17l	A	T	16: 13,940,999	I96L	probably benign	Het
Mrgpra9	A	T	7: 47,252,794	M1K	probably null	Het
Mycbp2	A	T	14: 103,156,667	H2819Q	probably benign	Het
Nav1	A	C	1: 135,448,917		probably benign	Het
Neurl4	T	C	11: 69,911,733		probably benign	Het
Ntng2	G	C	2: 29,207,426	P341R	probably damaging	Het
Oas1d	A	T	5: 120,917,028	Y221F	probably damaging	Het
Olfr1040	A	G	2: 86,146,630	Y35H	probably damaging	Het
Olfr348	C	A	2: 36,786,862	D112E	probably benign	Het
Olfr365	A	C	2: 37,202,184		probably null	Het
Osbpl8	A	G	10: 111,272,282	M380V	probably benign	Het
Pank1	T	C	19: 34,821,706		probably benign	Het
Parn	T	C	16: 13,654,476	D169G	possibly damaging	Het
Pknox1	T	A	17: 31,603,192	I311N	probably damaging	Het
Pprc1	T	C	19: 46,062,775	V248A	possibly damaging	Het
Prkcq	T	C	2: 11,254,234	C322R	probably benign	Het
Ptpn13	T	A	5: 103,555,062	I1298N	probably benign	Het
Rab11fip3	A	G	17: 26,069,072	S36P	probably benign	Het
Rif1	GCCACCA	GCCA	2: 52,110,324		probably benign	Het
Sass6	C	A	3: 116,607,308		probably benign	Het
Shroom3	G	A	5: 92,951,293	G1463D	probably benign	Het
Slc35d1	A	T	4: 103,184,887	Y249*	probably null	Het
Slc9a3	C	T	13: 74,121,536	P8S	unknown	Het
Slc9a9	T	A	9: 94,939,563		probably null	Het
Syne2	T	A	12: 75,986,975	M3666K	probably benign	Het
Synpo2	A	G	3: 123,079,897	V1140A	probably benign	Het
Thada	A	G	17: 84,231,096	F1495L	probably benign	Het
Timeless	A	G	10: 128,241,425		probably null	Het
Tlr6	G	T	5: 64,955,205	H120N	possibly damaging	Het
Tmem173	A	G	18: 35,735,111		probably null	Het
Tns3	T	C	11: 8,445,703	I1234V	probably benign	Het
Ttll9	A	G	2: 153,000,179	S318G	probably benign	Het
Vps13c	T	C	9: 67,922,915		probably benign	Het
Zfp933	T	C	4: 147,826,442	I232M	probably benign	Het
Zfyve27	T	C	19: 42,189,585	S382P	probably damaging	Het

Other mutations in Chd7

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00422:Chd7	APN	4	8859106	missense	probably damaging	1.00
IGL00510:Chd7	APN	4	8801404	missense	probably damaging	1.00
IGL00741:Chd7	APN	4	8839454	missense	probably damaging	1.00
IGL00796:Chd7	APN	4	8847271	missense	possibly damaging	0.95
IGL00907:Chd7	APN	4	8840435	missense	probably damaging	0.98
IGL00930:Chd7	APN	4	8805181	missense	probably damaging	1.00
IGL01542:Chd7	APN	4	8859285	missense	possibly damaging	0.71
IGL01602:Chd7	APN	4	8833834	missense	probably damaging	1.00
IGL01605:Chd7	APN	4	8833834	missense	probably damaging	1.00
IGL01670:Chd7	APN	4	8827033	missense	probably damaging	0.98
IGL02434:Chd7	APN	4	8752145	missense	probably benign	0.00
IGL02531:Chd7	APN	4	8854134	missense	probably damaging	1.00
IGL02626:Chd7	APN	4	8826519	missense	probably damaging	1.00
IGL02961:Chd7	APN	4	8751542	missense	probably damaging	1.00
IGL02972:Chd7	APN	4	8855174	missense	probably benign	0.30
IGL03329:Chd7	APN	4	8841108	missense	probably damaging	1.00
Fili	UTSW	4	8839523	missense	probably damaging	1.00
D4043:Chd7	UTSW	4	8862650	missense	probably damaging	1.00
IGL02991:Chd7	UTSW	4	8828398	missense	possibly damaging	0.91
PIT4466001:Chd7	UTSW	4	8753101	missense	unknown
PIT4472001:Chd7	UTSW	4	8753101	missense	unknown
R0157:Chd7	UTSW	4	8833759	missense	probably damaging	1.00
R0179:Chd7	UTSW	4	8862516	missense	probably benign	0.22
R0240:Chd7	UTSW	4	8852670	unclassified	probably benign
R0462:Chd7	UTSW	4	8850821	missense	probably damaging	1.00
R0512:Chd7	UTSW	4	8805139	intron	probably benign
R0657:Chd7	UTSW	4	8753141	missense	probably damaging	1.00
R0799:Chd7	UTSW	4	8801310	intron	probably benign
R0885:Chd7	UTSW	4	8866432	missense	probably damaging	1.00
R1056:Chd7	UTSW	4	8822402	missense	possibly damaging	0.50
R1086:Chd7	UTSW	4	8866458	missense	probably benign	0.04
R1353:Chd7	UTSW	4	8839556	missense	probably damaging	0.99
R1466:Chd7	UTSW	4	8840561	splice site	probably null
R1466:Chd7	UTSW	4	8840561	splice site	probably null
R1605:Chd7	UTSW	4	8844675	missense	probably damaging	1.00
R1693:Chd7	UTSW	4	8864307	critical splice donor site	probably null
R1695:Chd7	UTSW	4	8833960	missense	probably damaging	1.00
R1938:Chd7	UTSW	4	8847200	missense	probably damaging	1.00
R1964:Chd7	UTSW	4	8865978	missense	probably damaging	0.96
R2020:Chd7	UTSW	4	8855226	missense	probably benign	0.00
R2134:Chd7	UTSW	4	8753147	missense	probably damaging	0.99
R2171:Chd7	UTSW	4	8752424	missense	probably damaging	1.00
R2271:Chd7	UTSW	4	8785532	missense	probably damaging	1.00
R2300:Chd7	UTSW	4	8855241	missense	probably benign	0.02
R2355:Chd7	UTSW	4	8801350	missense	possibly damaging	0.95
R3153:Chd7	UTSW	4	8855174	missense	probably benign	0.30
R3430:Chd7	UTSW	4	8844517	missense	probably damaging	0.99
R3746:Chd7	UTSW	4	8752537	missense	probably damaging	1.00
R4118:Chd7	UTSW	4	8865831	missense	probably damaging	1.00
R4119:Chd7	UTSW	4	8785658	intron	probably benign
R4332:Chd7	UTSW	4	8854143	missense	probably damaging	1.00
R4402:Chd7	UTSW	4	8866353	missense	possibly damaging	0.61
R4571:Chd7	UTSW	4	8866217	missense	probably benign	0.09
R4722:Chd7	UTSW	4	8822445	missense	probably damaging	1.00
R4821:Chd7	UTSW	4	8844706	missense	probably damaging	1.00
R4894:Chd7	UTSW	4	8838629	missense	probably damaging	0.99
R5205:Chd7	UTSW	4	8752509	missense	possibly damaging	0.60
R5344:Chd7	UTSW	4	8844417	missense	probably damaging	1.00
R5484:Chd7	UTSW	4	8828258	missense	probably damaging	1.00
R5578:Chd7	UTSW	4	8847149	missense	probably benign	0.09
R5583:Chd7	UTSW	4	8752473	missense	probably damaging	1.00
R5888:Chd7	UTSW	4	8866382	missense	probably damaging	0.98
R5905:Chd7	UTSW	4	8840553	missense	possibly damaging	0.91
R6091:Chd7	UTSW	4	8751875	missense	probably damaging	0.99
R6126:Chd7	UTSW	4	8826482	missense	probably damaging	1.00
R6399:Chd7	UTSW	4	8828274	missense	probably damaging	1.00
R6751:Chd7	UTSW	4	8833866	missense	probably damaging	1.00
R6810:Chd7	UTSW	4	8839523	missense	probably damaging	1.00
R6868:Chd7	UTSW	4	8811501	splice site	probably null
R6952:Chd7	UTSW	4	8856797	missense	probably damaging	1.00
R6986:Chd7	UTSW	4	8859285	missense	possibly damaging	0.71
R6990:Chd7	UTSW	4	8844525	missense	probably benign	0.28
R7139:Chd7	UTSW	4	8865865	missense	probably benign	0.00
R7288:Chd7	UTSW	4	8847093	missense	possibly damaging	0.92
R7355:Chd7	UTSW	4	8752196	missense	unknown
R7452:Chd7	UTSW	4	8854731	missense	probably benign	0.03
R7471:Chd7	UTSW	4	8859197	missense	probably damaging	0.96
R7588:Chd7	UTSW	4	8864039	missense	probably damaging	1.00
R7711:Chd7	UTSW	4	8805234	missense	probably benign	0.00
R7744:Chd7	UTSW	4	8862485	splice site	probably null
R7842:Chd7	UTSW	4	8854115	missense	probably benign	0.01
R7883:Chd7	UTSW	4	8826504	missense	probably damaging	1.00
R7934:Chd7	UTSW	4	8854121	missense	probably benign	0.00
R7983:Chd7	UTSW	4	8752628	missense	unknown
R7983:Chd7	UTSW	4	8844609	missense	possibly damaging	0.47
R8022:Chd7	UTSW	4	8751605	missense	unknown
R8161:Chd7	UTSW	4	8855038	missense	probably damaging	1.00
R8274:Chd7	UTSW	4	8839432	missense	probably damaging	1.00
R8278:Chd7	UTSW	4	8862485	splice site	probably null
R8358:Chd7	UTSW	4	8839529	missense	probably damaging	1.00
R8464:Chd7	UTSW	4	8811465	missense	probably benign	0.06
R8483:Chd7	UTSW	4	8822412	missense	possibly damaging	0.65
R8507:Chd7	UTSW	4	8858675	missense	probably damaging	1.00
R8535:Chd7	UTSW	4	8859211	missense	possibly damaging	0.92
R8695:Chd7	UTSW	4	8850812	missense	probably damaging	1.00
R8700:Chd7	UTSW	4	8833892	missense	probably damaging	1.00
R8755:Chd7	UTSW	4	8866069	missense	probably benign	0.31
R8774:Chd7	UTSW	4	8854692	missense	probably damaging	1.00
R8774-TAIL:Chd7	UTSW	4	8854692	missense	probably damaging	1.00
R8796:Chd7	UTSW	4	8838691	missense	probably damaging	1.00
R8992:Chd7	UTSW	4	8839589	missense	probably damaging	1.00
R9018:Chd7	UTSW	4	8847083	missense	possibly damaging	0.88
R9122:Chd7	UTSW	4	8840510	missense	possibly damaging	0.77
R9131:Chd7	UTSW	4	8785642	missense
R9182:Chd7	UTSW	4	8838737	missense	probably damaging	1.00
R9227:Chd7	UTSW	4	8805272	missense	probably benign	0.03
R9254:Chd7	UTSW	4	8752210	missense	unknown
R9379:Chd7	UTSW	4	8752210	missense	unknown
R9388:Chd7	UTSW	4	8865756	missense	possibly damaging	0.89
R9455:Chd7	UTSW	4	8752061	missense	unknown
R9531:Chd7	UTSW	4	8858489	missense
R9577:Chd7	UTSW	4	8752964	missense	unknown
R9634:Chd7	UTSW	4	8832499	missense	probably damaging	1.00
Z1176:Chd7	UTSW	4	8844313	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TTCCACTTCCTCAGGCAAGCACAG -3'
(R):5'- GCAGTGCAGCTCGTCTTTCATTCG -3'

Sequencing Primer
(F):5'- AATGCTGAGTTAGGTCAGCTCTAC -3'
(R):5'- CGTGTACCTACCGTCCTCG -3'

Posted On

2013-04-24