Incidental Mutation 'R4049:Map1lc3a'
ID314019
Institutional Source Beutler Lab
Gene Symbol Map1lc3a
Ensembl Gene ENSMUSG00000027602
Gene Namemicrotubule-associated protein 1 light chain 3 alpha
Synonyms4922501H04Rik, LC3, 1010001H21Rik, LC3a
MMRRC Submission 041616-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.367) question?
Stock #R4049 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location155276297-155278073 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 155277542 bp
ZygosityHeterozygous
Amino Acid Change Valine to Phenylalanine at position 91 (V91F)
Ref Sequence ENSEMBL: ENSMUSP00000029128 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029128] [ENSMUST00000077626] [ENSMUST00000165234]
Predicted Effect possibly damaging
Transcript: ENSMUST00000029128
AA Change: V91F

PolyPhen 2 Score 0.942 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000029128
Gene: ENSMUSG00000027602
AA Change: V91F

DomainStartEndE-ValueType
Pfam:Atg8 15 120 9.1e-47 PFAM
Pfam:APG12 33 120 4.3e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000077626
SMART Domains Protein: ENSMUSP00000076816
Gene: ENSMUSG00000038383

DomainStartEndE-ValueType
Pfam:PIG-U 10 394 2.6e-119 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139854
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145086
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154596
Predicted Effect probably benign
Transcript: ENSMUST00000165234
SMART Domains Protein: ENSMUSP00000126236
Gene: ENSMUSG00000038383

DomainStartEndE-ValueType
Pfam:PIG-U 10 393 1.7e-116 PFAM
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.6%
Validation Efficiency 100% (65/65)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] MAP1A and MAP1B are microtubule-associated proteins which mediate the physical interactions between microtubules and components of the cytoskeleton. MAP1A and MAP1B each consist of a heavy chain subunit and multiple light chain subunits. The protein encoded by this gene is one of the light chain subunits and can associate with either MAP1A or MAP1B. Two transcript variants encoding different isoforms have been found for this gene. The expression of variant 1 is suppressed in many tumor cell lines, suggesting that may be involved in carcinogenesis. [provided by RefSeq, Feb 2012]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb5 T A 12: 118,868,669 E1190V probably damaging Het
Arhgef10 A G 8: 14,979,998 T928A probably benign Het
Arhgef10l T A 4: 140,515,451 I836F probably benign Het
Blm T A 7: 80,502,862 T446S probably benign Het
Ccdc63 T A 5: 122,122,750 Q237L probably damaging Het
Cep57l1 G T 10: 41,729,360 R130S probably damaging Het
Clstn2 T G 9: 97,457,560 E786A possibly damaging Het
Col16a1 C T 4: 130,068,752 P540L probably damaging Het
Csf2 A G 11: 54,249,333 F61L probably damaging Het
Ctr9 C T 7: 111,055,543 R1094C unknown Het
Cyp3a41a A G 5: 145,713,540 C98R probably damaging Het
Dthd1 T A 5: 62,827,165 C404* probably null Het
Egfem1 A C 3: 29,686,731 H518P probably benign Het
Elf3 T C 1: 135,254,277 S369G probably benign Het
Eml6 C T 11: 29,838,577 V503M probably damaging Het
Enthd1 T C 15: 80,560,039 D105G probably damaging Het
Eral1 A G 11: 78,075,602 L250P probably damaging Het
Gdf15 A T 8: 70,629,955 M167K probably benign Het
Ggps1 T C 13: 14,053,699 K300E probably benign Het
Gm8074 G A 9: 78,322,336 noncoding transcript Het
Herc3 A G 6: 58,876,837 I623V probably damaging Het
Mad1l1 A G 5: 140,132,816 S457P probably damaging Het
Map4k3 A G 17: 80,605,965 V617A probably benign Het
Mov10l1 T A 15: 88,995,032 probably benign Het
Mroh2a A G 1: 88,258,664 S64G probably benign Het
Ncor1 G T 11: 62,329,668 probably null Het
Nfe2 C T 15: 103,250,937 E36K possibly damaging Het
Olfr1176 T C 2: 88,343,800 probably null Het
Olfr1212 A G 2: 88,959,273 K269R probably benign Het
Olfr1251 T C 2: 89,667,662 I75V probably benign Het
Olfr653 T C 7: 104,580,368 F241L probably benign Het
Oprm1 G A 10: 6,829,087 V95I probably benign Het
Pcdha9 T A 18: 36,997,942 H21Q probably benign Het
Pcolce2 A T 9: 95,638,755 I62F probably damaging Het
Pfpl T A 19: 12,429,689 C435S probably damaging Het
Pkhd1l1 G A 15: 44,498,557 C542Y probably damaging Het
Plekha5 T C 6: 140,583,871 S75P probably damaging Het
Pphln1 C A 15: 93,465,106 A202E probably damaging Het
Ppp1r1a A G 15: 103,532,454 L92P probably damaging Het
Prokr2 T C 2: 132,381,494 T43A probably benign Het
Rai14 T C 15: 10,592,212 N199S probably benign Het
Rasgrp2 T C 19: 6,404,727 L199P probably damaging Het
Rnf213 A C 11: 119,482,448 M4939L possibly damaging Het
Slc23a2 C T 2: 132,060,683 R533Q probably benign Het
Slc7a7 T C 14: 54,373,091 probably null Het
Snrpd2 T A 7: 19,151,307 V31E probably damaging Het
Spire1 G T 18: 67,529,031 probably null Het
Srsf4 T C 4: 131,900,543 probably benign Het
Tcf20 A G 15: 82,853,429 S1274P probably damaging Het
Tcof1 C A 18: 60,832,903 A376S possibly damaging Het
Thsd1 T A 8: 22,243,164 Y76N possibly damaging Het
Timm44 A G 8: 4,260,561 V397A probably benign Het
Tmc6 G A 11: 117,778,261 T89I possibly damaging Het
Trbv31 C A 6: 41,557,705 C107F probably damaging Het
Trim37 T A 11: 87,140,603 probably null Het
Ttll5 T C 12: 86,012,799 V1226A probably benign Het
Ube3b T C 5: 114,412,870 V865A probably benign Het
Vmn2r86 A T 10: 130,447,097 M550K probably damaging Het
Vps54 C A 11: 21,300,183 T373N probably benign Het
Wdr64 T G 1: 175,805,856 I891S probably benign Het
Wisp2 A G 2: 163,828,984 D137G probably damaging Het
Zfhx4 C T 3: 5,398,859 S1384L probably damaging Het
Zfp703 A G 8: 26,979,085 E259G possibly damaging Het
Zfp933 T C 4: 147,826,512 H209R probably damaging Het
Zfp980 A G 4: 145,702,600 H633R probably damaging Het
Other mutations in Map1lc3a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03156:Map1lc3a APN 2 155277009 missense probably damaging 1.00
R0734:Map1lc3a UTSW 2 155276976 missense possibly damaging 0.54
R6213:Map1lc3a UTSW 2 155277015 critical splice donor site probably null
X0027:Map1lc3a UTSW 2 155277632 missense probably benign
Predicted Primers PCR Primer
(F):5'- CGAGCTTCAGTAGAGGTGAG -3'
(R):5'- ATCTCTGCCTAATCCACTGGGG -3'

Sequencing Primer
(F):5'- ATTTTGGGAGGGTCACCT -3'
(R):5'- TCCACTGGGGACTGAAATAGCTTAG -3'
Posted On2015-04-30