Incidental Mutation 'R0388:Slc35d1'
ID 31402
Institutional Source Beutler Lab
Gene Symbol Slc35d1
Ensembl Gene ENSMUSG00000028521
Gene Name solute carrier family 35 (UDP-glucuronic acid/UDP-N-acetylgalactosamine dual transporter), member D1
Synonyms UGTREL7
MMRRC Submission 038594-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R0388 (G1)
Quality Score 225
Status Validated
Chromosome 4
Chromosomal Location 103170649-103215164 bp(-) (GRCm38)
Type of Mutation nonsense
DNA Base Change (assembly) A to T at 103184887 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Stop codon at position 249 (Y249*)
Ref Sequence ENSEMBL: ENSMUSP00000122124 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036195] [ENSMUST00000150285]
AlphaFold no structure available at present
Predicted Effect probably null
Transcript: ENSMUST00000036195
AA Change: Y277*
SMART Domains Protein: ENSMUSP00000037617
Gene: ENSMUSG00000028521
AA Change: Y277*

DomainStartEndE-ValueType
Pfam:TPT 18 307 6.4e-18 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000150285
AA Change: Y249*
SMART Domains Protein: ENSMUSP00000122124
Gene: ENSMUSG00000028521
AA Change: Y249*

DomainStartEndE-ValueType
transmembrane domain 37 59 N/A INTRINSIC
transmembrane domain 69 88 N/A INTRINSIC
transmembrane domain 158 177 N/A INTRINSIC
transmembrane domain 187 205 N/A INTRINSIC
transmembrane domain 217 239 N/A INTRINSIC
transmembrane domain 259 281 N/A INTRINSIC
Meta Mutation Damage Score 0.9712 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.0%
  • 10x: 95.6%
  • 20x: 90.7%
Validation Efficiency 100% (67/67)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Glycosylation of cellular glycoconjugates occurs in the endoplasmic reticulum (ER) and Golgi compartment, and requires transport of nucleotide sugars from the cytosol into the lumen of the ER and Golgi by specific transporters. The protein encoded by this gene resides in the ER, and transports both UDP-glucuronic acid (UDP-GlcA) and UDP-N-acetylgalactosamine (UDP-GalNAc) from the cytoplasm to the ER lumen. It may participate in glucuronidation and/or chondroitin sulfate biosynthesis. Mutations in this gene are associated with Schneckenbecken dysplasia.[provided by RefSeq, Sep 2009]
PHENOTYPE: Mice homozygous for a null allele exhibit neonatal lethality and chondrodystrophy associated with impaired chondroitin sulfate biosynthesis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010315B03Rik T C 9: 124,295,159 probably benign Het
Acsbg1 T C 9: 54,609,063 K678R probably damaging Het
Adgrg6 A G 10: 14,450,658 I410T probably benign Het
Afap1l2 A C 19: 56,917,242 probably benign Het
Aox2 T C 1: 58,354,406 Y1242H probably damaging Het
Apoo-ps T C 13: 107,414,673 noncoding transcript Het
Camta1 C A 4: 151,075,140 R1614L probably damaging Het
Cdh3 C A 8: 106,539,129 T268K probably damaging Het
Chd5 T A 4: 152,371,644 H923Q probably damaging Het
Chd7 T C 4: 8,854,560 V1967A probably benign Het
Cntn3 T C 6: 102,277,316 M222V probably damaging Het
Dcaf17 A G 2: 71,078,571 K277R probably benign Het
Dmbt1 T C 7: 131,096,049 probably benign Het
Dmpk T A 7: 19,084,077 probably benign Het
Dzank1 A T 2: 144,476,106 L714Q possibly damaging Het
Efcab3 A G 11: 105,109,401 D272G possibly damaging Het
Erbb2 G C 11: 98,427,351 R471P possibly damaging Het
Esf1 T A 2: 140,120,871 Y760F possibly damaging Het
Fanci C A 7: 79,439,630 T938K probably benign Het
Gnai3 A G 3: 108,115,757 probably benign Het
Hspg2 T A 4: 137,511,158 C319S probably damaging Het
Il12a T A 3: 68,695,187 probably null Het
Inpp4a A G 1: 37,396,160 D837G probably damaging Het
Kcnj5 T A 9: 32,317,863 E13V probably damaging Het
Kcnq3 T A 15: 66,000,038 Y594F probably benign Het
Kif16b T C 2: 142,740,937 E556G probably damaging Het
Kif28 T C 1: 179,740,089 I39V possibly damaging Het
Lgi2 T C 5: 52,554,549 E143G probably damaging Het
Mast1 T G 8: 84,915,537 I1063L probably benign Het
Med12l T C 3: 59,093,504 probably benign Het
Mmp19 G T 10: 128,798,883 R456L probably benign Het
Mon1b T A 8: 113,639,078 V346E probably damaging Het
Mpv17l A T 16: 13,940,999 I96L probably benign Het
Mrgpra9 A T 7: 47,252,794 M1K probably null Het
Mycbp2 A T 14: 103,156,667 H2819Q probably benign Het
Nav1 A C 1: 135,448,917 probably benign Het
Neurl4 T C 11: 69,911,733 probably benign Het
Ntng2 G C 2: 29,207,426 P341R probably damaging Het
Oas1d A T 5: 120,917,028 Y221F probably damaging Het
Olfr1040 A G 2: 86,146,630 Y35H probably damaging Het
Olfr348 C A 2: 36,786,862 D112E probably benign Het
Olfr365 A C 2: 37,202,184 probably null Het
Osbpl8 A G 10: 111,272,282 M380V probably benign Het
Pank1 T C 19: 34,821,706 probably benign Het
Parn T C 16: 13,654,476 D169G possibly damaging Het
Pknox1 T A 17: 31,603,192 I311N probably damaging Het
Pprc1 T C 19: 46,062,775 V248A possibly damaging Het
Prkcq T C 2: 11,254,234 C322R probably benign Het
Ptpn13 T A 5: 103,555,062 I1298N probably benign Het
Rab11fip3 A G 17: 26,069,072 S36P probably benign Het
Rif1 GCCACCA GCCA 2: 52,110,324 probably benign Het
Sass6 C A 3: 116,607,308 probably benign Het
Shroom3 G A 5: 92,951,293 G1463D probably benign Het
Slc9a3 C T 13: 74,121,536 P8S unknown Het
Slc9a9 T A 9: 94,939,563 probably null Het
Syne2 T A 12: 75,986,975 M3666K probably benign Het
Synpo2 A G 3: 123,079,897 V1140A probably benign Het
Thada A G 17: 84,231,096 F1495L probably benign Het
Timeless A G 10: 128,241,425 probably null Het
Tlr6 G T 5: 64,955,205 H120N possibly damaging Het
Tmem173 A G 18: 35,735,111 probably null Het
Tns3 T C 11: 8,445,703 I1234V probably benign Het
Ttll9 A G 2: 153,000,179 S318G probably benign Het
Vps13c T C 9: 67,922,915 probably benign Het
Zfp933 T C 4: 147,826,442 I232M probably benign Het
Zfyve27 T C 19: 42,189,585 S382P probably damaging Het
Other mutations in Slc35d1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02088:Slc35d1 APN 4 103211325 missense probably benign 0.00
IGL03198:Slc35d1 APN 4 103184888 missense probably damaging 1.00
R0131:Slc35d1 UTSW 4 103208181 missense probably benign 0.01
R0131:Slc35d1 UTSW 4 103208181 missense probably benign 0.01
R0132:Slc35d1 UTSW 4 103208181 missense probably benign 0.01
R0206:Slc35d1 UTSW 4 103208154 missense probably damaging 1.00
R0206:Slc35d1 UTSW 4 103208154 missense probably damaging 1.00
R0208:Slc35d1 UTSW 4 103208154 missense probably damaging 1.00
R0270:Slc35d1 UTSW 4 103190838 missense probably damaging 0.98
R0346:Slc35d1 UTSW 4 103190847 missense probably damaging 0.96
R0638:Slc35d1 UTSW 4 103213244 splice site probably benign
R2146:Slc35d1 UTSW 4 103205152 missense probably damaging 0.99
R3722:Slc35d1 UTSW 4 103208124 missense possibly damaging 0.93
R4649:Slc35d1 UTSW 4 103213229 missense probably damaging 1.00
R5137:Slc35d1 UTSW 4 103214781 missense possibly damaging 0.71
R5327:Slc35d1 UTSW 4 103213186 missense probably damaging 1.00
R5351:Slc35d1 UTSW 4 103189839 missense probably damaging 1.00
R5395:Slc35d1 UTSW 4 103211375 critical splice acceptor site probably null
R6263:Slc35d1 UTSW 4 103208168 missense possibly damaging 0.93
R6470:Slc35d1 UTSW 4 103189822 missense probably damaging 1.00
R7344:Slc35d1 UTSW 4 103213046 splice site probably null
R7388:Slc35d1 UTSW 4 103189785 critical splice donor site probably null
R7580:Slc35d1 UTSW 4 103208133 missense
R7729:Slc35d1 UTSW 4 103214847 missense probably damaging 0.99
R7942:Slc35d1 UTSW 4 103213163 critical splice donor site probably null
R8408:Slc35d1 UTSW 4 103189810 missense
R8444:Slc35d1 UTSW 4 103214699 missense
R8692:Slc35d1 UTSW 4 103189854 missense
R8730:Slc35d1 UTSW 4 103173754 missense
R8868:Slc35d1 UTSW 4 103208154 missense probably damaging 1.00
R8894:Slc35d1 UTSW 4 103211332 missense
R9251:Slc35d1 UTSW 4 103190830 critical splice donor site probably null
R9357:Slc35d1 UTSW 4 103208136 missense
R9789:Slc35d1 UTSW 4 103214749 missense
Predicted Primers PCR Primer
(F):5'- GCATGAATATGGAACCACTGCCTTTG -3'
(R):5'- GCTACACGCAGGTGATAGACCTTTG -3'

Sequencing Primer
(F):5'- GCCTAATCCTATGCTGTGACACT -3'
(R):5'- CAGGTGATAGACCTTTGTTGGAAC -3'
Posted On 2013-04-24