Incidental Mutation 'R4049:Srsf4'
ID314024
Institutional Source Beutler Lab
Gene Symbol Srsf4
Ensembl Gene ENSMUSG00000028911
Gene Nameserine/arginine-rich splicing factor 4
SynonymsMNCb-2616, Sfrs4, SRp75, 5730499P16Rik
MMRRC Submission 041616-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.351) question?
Stock #R4049 (G1)
Quality Score199
Status Validated
Chromosome4
Chromosomal Location131873617-131901706 bp(+) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) T to C at 131900543 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000142148 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053819] [ENSMUST00000134943]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000030743
SMART Domains Protein: ENSMUSP00000030743
Gene: ENSMUSG00000028911

DomainStartEndE-ValueType
RRM 14 73 1.09e0 SMART
low complexity region 76 102 N/A INTRINSIC
RRM 110 178 2e-14 SMART
low complexity region 184 277 N/A INTRINSIC
low complexity region 304 328 N/A INTRINSIC
low complexity region 329 408 N/A INTRINSIC
low complexity region 460 496 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000053819
AA Change: V316A
SMART Domains Protein: ENSMUSP00000061474
Gene: ENSMUSG00000028911
AA Change: V316A

DomainStartEndE-ValueType
RRM 3 68 4.3e-21 SMART
low complexity region 71 97 N/A INTRINSIC
RRM 105 173 8.4e-17 SMART
low complexity region 179 272 N/A INTRINSIC
low complexity region 299 323 N/A INTRINSIC
low complexity region 324 403 N/A INTRINSIC
low complexity region 455 490 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000121250
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124738
Predicted Effect probably benign
Transcript: ENSMUST00000134943
Meta Mutation Damage Score 0.0605 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.6%
Validation Efficiency 100% (65/65)
MGI Phenotype FUNCTION: The protein encoded by this gene is a member of the serine/arginine (SR)-rich family of pre-mRNA splicing factors, which constitute part of the spliceosome. Each of these factors contains an RNA recognition motif (RRM) for binding RNA and an RS domain for binding other proteins. The RS domain is rich in serine and arginine residues and facilitates interaction between different SR splicing factors. In addition to being critical for mRNA splicing, the SR proteins have also been shown to be involved in mRNA export from the nucleus and in translation. [provided by RefSeq, Sep 2010]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb5 T A 12: 118,868,669 E1190V probably damaging Het
Arhgef10 A G 8: 14,979,998 T928A probably benign Het
Arhgef10l T A 4: 140,515,451 I836F probably benign Het
Blm T A 7: 80,502,862 T446S probably benign Het
Ccdc63 T A 5: 122,122,750 Q237L probably damaging Het
Cep57l1 G T 10: 41,729,360 R130S probably damaging Het
Clstn2 T G 9: 97,457,560 E786A possibly damaging Het
Col16a1 C T 4: 130,068,752 P540L probably damaging Het
Csf2 A G 11: 54,249,333 F61L probably damaging Het
Ctr9 C T 7: 111,055,543 R1094C unknown Het
Cyp3a41a A G 5: 145,713,540 C98R probably damaging Het
Dthd1 T A 5: 62,827,165 C404* probably null Het
Egfem1 A C 3: 29,686,731 H518P probably benign Het
Elf3 T C 1: 135,254,277 S369G probably benign Het
Eml6 C T 11: 29,838,577 V503M probably damaging Het
Enthd1 T C 15: 80,560,039 D105G probably damaging Het
Eral1 A G 11: 78,075,602 L250P probably damaging Het
Gdf15 A T 8: 70,629,955 M167K probably benign Het
Ggps1 T C 13: 14,053,699 K300E probably benign Het
Gm8074 G A 9: 78,322,336 noncoding transcript Het
Herc3 A G 6: 58,876,837 I623V probably damaging Het
Mad1l1 A G 5: 140,132,816 S457P probably damaging Het
Map1lc3a G T 2: 155,277,542 V91F possibly damaging Het
Map4k3 A G 17: 80,605,965 V617A probably benign Het
Mov10l1 T A 15: 88,995,032 probably benign Het
Mroh2a A G 1: 88,258,664 S64G probably benign Het
Ncor1 G T 11: 62,329,668 probably null Het
Nfe2 C T 15: 103,250,937 E36K possibly damaging Het
Olfr1176 T C 2: 88,343,800 probably null Het
Olfr1212 A G 2: 88,959,273 K269R probably benign Het
Olfr1251 T C 2: 89,667,662 I75V probably benign Het
Olfr653 T C 7: 104,580,368 F241L probably benign Het
Oprm1 G A 10: 6,829,087 V95I probably benign Het
Pcdha9 T A 18: 36,997,942 H21Q probably benign Het
Pcolce2 A T 9: 95,638,755 I62F probably damaging Het
Pfpl T A 19: 12,429,689 C435S probably damaging Het
Pkhd1l1 G A 15: 44,498,557 C542Y probably damaging Het
Plekha5 T C 6: 140,583,871 S75P probably damaging Het
Pphln1 C A 15: 93,465,106 A202E probably damaging Het
Ppp1r1a A G 15: 103,532,454 L92P probably damaging Het
Prokr2 T C 2: 132,381,494 T43A probably benign Het
Rai14 T C 15: 10,592,212 N199S probably benign Het
Rasgrp2 T C 19: 6,404,727 L199P probably damaging Het
Rnf213 A C 11: 119,482,448 M4939L possibly damaging Het
Slc23a2 C T 2: 132,060,683 R533Q probably benign Het
Slc7a7 T C 14: 54,373,091 probably null Het
Snrpd2 T A 7: 19,151,307 V31E probably damaging Het
Spire1 G T 18: 67,529,031 probably null Het
Tcf20 A G 15: 82,853,429 S1274P probably damaging Het
Tcof1 C A 18: 60,832,903 A376S possibly damaging Het
Thsd1 T A 8: 22,243,164 Y76N possibly damaging Het
Timm44 A G 8: 4,260,561 V397A probably benign Het
Tmc6 G A 11: 117,778,261 T89I possibly damaging Het
Trbv31 C A 6: 41,557,705 C107F probably damaging Het
Trim37 T A 11: 87,140,603 probably null Het
Ttll5 T C 12: 86,012,799 V1226A probably benign Het
Ube3b T C 5: 114,412,870 V865A probably benign Het
Vmn2r86 A T 10: 130,447,097 M550K probably damaging Het
Vps54 C A 11: 21,300,183 T373N probably benign Het
Wdr64 T G 1: 175,805,856 I891S probably benign Het
Wisp2 A G 2: 163,828,984 D137G probably damaging Het
Zfhx4 C T 3: 5,398,859 S1384L probably damaging Het
Zfp703 A G 8: 26,979,085 E259G possibly damaging Het
Zfp933 T C 4: 147,826,512 H209R probably damaging Het
Zfp980 A G 4: 145,702,600 H633R probably damaging Het
Other mutations in Srsf4
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0087:Srsf4 UTSW 4 131900330 unclassified probably benign
R1135:Srsf4 UTSW 4 131900069 unclassified probably benign
R1209:Srsf4 UTSW 4 131901059 unclassified probably benign
R1276:Srsf4 UTSW 4 131897685 missense probably damaging 1.00
R1561:Srsf4 UTSW 4 131897695 missense probably damaging 1.00
R1574:Srsf4 UTSW 4 131897695 missense probably damaging 1.00
R1700:Srsf4 UTSW 4 131900560 unclassified probably benign
R2265:Srsf4 UTSW 4 131897682 missense probably damaging 1.00
R2269:Srsf4 UTSW 4 131897682 missense probably damaging 1.00
R3723:Srsf4 UTSW 4 131900102 unclassified probably benign
R3724:Srsf4 UTSW 4 131900102 unclassified probably benign
R3737:Srsf4 UTSW 4 131900102 unclassified probably benign
R3738:Srsf4 UTSW 4 131900102 unclassified probably benign
R3739:Srsf4 UTSW 4 131900102 unclassified probably benign
R4034:Srsf4 UTSW 4 131900102 unclassified probably benign
R4035:Srsf4 UTSW 4 131900102 unclassified probably benign
R4535:Srsf4 UTSW 4 131873864 missense probably damaging 1.00
R4810:Srsf4 UTSW 4 131900102 unclassified probably benign
R4833:Srsf4 UTSW 4 131900102 unclassified probably benign
R4932:Srsf4 UTSW 4 131891245 missense probably damaging 0.99
R5291:Srsf4 UTSW 4 131886306 critical splice donor site probably benign
R5725:Srsf4 UTSW 4 131900951 unclassified probably benign
R6145:Srsf4 UTSW 4 131900294 unclassified probably benign
R7056:Srsf4 UTSW 4 131900693 unclassified probably benign
R7294:Srsf4 UTSW 4 131900461 missense unknown
Predicted Primers PCR Primer
(F):5'- TGTCTTCCAGGTCAGGTTCC -3'
(R):5'- TGCTGCTGCTACTGACTTTG -3'

Sequencing Primer
(F):5'- AGGTCAGGTTCCCACTCC -3'
(R):5'- GCTGCTACTGACTTTGCTGTC -3'
Posted On2015-04-30