Incidental Mutation 'R4049:Ube3b'
ID 314029
Institutional Source Beutler Lab
Gene Symbol Ube3b
Ensembl Gene ENSMUSG00000029577
Gene Name ubiquitin protein ligase E3B
Synonyms
MMRRC Submission 041616-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R4049 (G1)
Quality Score 168
Status Validated
Chromosome 5
Chromosomal Location 114518668-114559230 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 114550931 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 865 (V865A)
Ref Sequence ENSEMBL: ENSMUSP00000073652 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074002] [ENSMUST00000130169]
AlphaFold Q9ES34
Predicted Effect probably benign
Transcript: ENSMUST00000074002
AA Change: V865A

PolyPhen 2 Score 0.091 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000073652
Gene: ENSMUSG00000029577
AA Change: V865A

DomainStartEndE-ValueType
IQ 28 50 1.17e-2 SMART
low complexity region 310 327 N/A INTRINSIC
low complexity region 412 428 N/A INTRINSIC
low complexity region 470 488 N/A INTRINSIC
HECTc 697 1070 2.15e-110 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000130169
SMART Domains Protein: ENSMUSP00000138723
Gene: ENSMUSG00000029577

DomainStartEndE-ValueType
IQ 28 50 1.17e-2 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150630
Predicted Effect probably benign
Transcript: ENSMUST00000196651
SMART Domains Protein: ENSMUSP00000143455
Gene: ENSMUSG00000029577

DomainStartEndE-ValueType
HECTc 122 495 1.1e-112 SMART
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.6%
Validation Efficiency 100% (65/65)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The modification of proteins with ubiquitin is an important cellular mechanism for targeting abnormal or short-lived proteins for degradation. Ubiquitination involves at least three classes of enzymes: E1 ubiquitin-activating enzymes, E2 ubiquitin-conjugating enzymes, and E3 ubiquitin-protein ligases. This gene encodes a member of the E3 ubiquitin-conjugating enzyme family which accepts ubiquitin from an E2 ubiquitin-conjugating enzyme and transfers the ubiquitin to the targeted substrates. A HECT (homology to E6-AP C-terminus) domain in the C-terminus of the longer isoform of this protein is the catalytic site of ubiquitin transfer and forms a complex with E2 conjugases. Shorter isoforms of this protein which lack the C-terminal HECT domain are therefore unlikely to bind E2 enzymes. Alternatively spliced transcript variants encoding distinct isoforms have been identified for this gene. [provided by RefSeq, Jul 2012]
PHENOTYPE: Mice homozygous for a gene trap allele exhibit preweaning lethality, reduced fertility, decreased growth, reduced grip strength, impaired hearing, eye inflammation and decreased cholesterol level. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb5 T A 12: 118,832,404 (GRCm39) E1190V probably damaging Het
Arhgef10 A G 8: 15,029,998 (GRCm39) T928A probably benign Het
Arhgef10l T A 4: 140,242,762 (GRCm39) I836F probably benign Het
Blm T A 7: 80,152,610 (GRCm39) T446S probably benign Het
Ccdc63 T A 5: 122,260,813 (GRCm39) Q237L probably damaging Het
Ccn5 A G 2: 163,670,904 (GRCm39) D137G probably damaging Het
Cep57l1 G T 10: 41,605,356 (GRCm39) R130S probably damaging Het
Clstn2 T G 9: 97,339,613 (GRCm39) E786A possibly damaging Het
Col16a1 C T 4: 129,962,545 (GRCm39) P540L probably damaging Het
Csf2 A G 11: 54,140,159 (GRCm39) F61L probably damaging Het
Ctr9 C T 7: 110,654,750 (GRCm39) R1094C unknown Het
Cyp3a41a A G 5: 145,650,350 (GRCm39) C98R probably damaging Het
Dthd1 T A 5: 62,984,508 (GRCm39) C404* probably null Het
Egfem1 A C 3: 29,740,880 (GRCm39) H518P probably benign Het
Elf3 T C 1: 135,182,015 (GRCm39) S369G probably benign Het
Eml6 C T 11: 29,788,577 (GRCm39) V503M probably damaging Het
Enthd1 T C 15: 80,444,240 (GRCm39) D105G probably damaging Het
Eral1 A G 11: 77,966,428 (GRCm39) L250P probably damaging Het
Gdf15 A T 8: 71,082,605 (GRCm39) M167K probably benign Het
Ggps1 T C 13: 14,228,284 (GRCm39) K300E probably benign Het
Gm8074 G A 9: 78,229,618 (GRCm39) noncoding transcript Het
Herc3 A G 6: 58,853,822 (GRCm39) I623V probably damaging Het
Mad1l1 A G 5: 140,118,571 (GRCm39) S457P probably damaging Het
Map1lc3a G T 2: 155,119,462 (GRCm39) V91F possibly damaging Het
Map4k3 A G 17: 80,913,394 (GRCm39) V617A probably benign Het
Mov10l1 T A 15: 88,879,235 (GRCm39) probably benign Het
Mroh2a A G 1: 88,186,386 (GRCm39) S64G probably benign Het
Ncor1 G T 11: 62,220,494 (GRCm39) probably null Het
Nfe2 C T 15: 103,159,364 (GRCm39) E36K possibly damaging Het
Oprm1 G A 10: 6,779,087 (GRCm39) V95I probably benign Het
Or4a78 T C 2: 89,498,006 (GRCm39) I75V probably benign Het
Or4c107 A G 2: 88,789,617 (GRCm39) K269R probably benign Het
Or52d3 T C 7: 104,229,575 (GRCm39) F241L probably benign Het
Or5d46 T C 2: 88,174,144 (GRCm39) probably null Het
Pcdha9 T A 18: 37,130,995 (GRCm39) H21Q probably benign Het
Pcolce2 A T 9: 95,520,808 (GRCm39) I62F probably damaging Het
Pfpl T A 19: 12,407,053 (GRCm39) C435S probably damaging Het
Pkhd1l1 G A 15: 44,361,953 (GRCm39) C542Y probably damaging Het
Plekha5 T C 6: 140,529,597 (GRCm39) S75P probably damaging Het
Pphln1 C A 15: 93,362,987 (GRCm39) A202E probably damaging Het
Ppp1r1a A G 15: 103,440,881 (GRCm39) L92P probably damaging Het
Prokr2 T C 2: 132,223,414 (GRCm39) T43A probably benign Het
Rai14 T C 15: 10,592,298 (GRCm39) N199S probably benign Het
Rasgrp2 T C 19: 6,454,757 (GRCm39) L199P probably damaging Het
Rnf213 A C 11: 119,373,274 (GRCm39) M4939L possibly damaging Het
Slc23a2 C T 2: 131,902,603 (GRCm39) R533Q probably benign Het
Slc7a7 T C 14: 54,610,548 (GRCm39) probably null Het
Snrpd2 T A 7: 18,885,232 (GRCm39) V31E probably damaging Het
Spire1 G T 18: 67,662,101 (GRCm39) probably null Het
Srsf4 T C 4: 131,627,854 (GRCm39) probably benign Het
Tcf20 A G 15: 82,737,630 (GRCm39) S1274P probably damaging Het
Tcof1 C A 18: 60,965,975 (GRCm39) A376S possibly damaging Het
Thsd1 T A 8: 22,733,180 (GRCm39) Y76N possibly damaging Het
Timm44 A G 8: 4,310,561 (GRCm39) V397A probably benign Het
Tmc6 G A 11: 117,669,087 (GRCm39) T89I possibly damaging Het
Trbv31 C A 6: 41,534,639 (GRCm39) C107F probably damaging Het
Trim37 T A 11: 87,031,429 (GRCm39) probably null Het
Ttll5 T C 12: 86,059,573 (GRCm39) V1226A probably benign Het
Vmn2r86 A T 10: 130,282,966 (GRCm39) M550K probably damaging Het
Vps54 C A 11: 21,250,183 (GRCm39) T373N probably benign Het
Wdr64 T G 1: 175,633,422 (GRCm39) I891S probably benign Het
Zfhx4 C T 3: 5,463,919 (GRCm39) S1384L probably damaging Het
Zfp703 A G 8: 27,469,113 (GRCm39) E259G possibly damaging Het
Zfp933 T C 4: 147,910,969 (GRCm39) H209R probably damaging Het
Zfp980 A G 4: 145,429,170 (GRCm39) H633R probably damaging Het
Other mutations in Ube3b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00754:Ube3b APN 5 114,553,348 (GRCm39) missense possibly damaging 0.93
IGL01154:Ube3b APN 5 114,544,313 (GRCm39) missense probably null 0.86
IGL02632:Ube3b APN 5 114,536,902 (GRCm39) missense probably benign
IGL02850:Ube3b APN 5 114,544,310 (GRCm39) missense probably damaging 1.00
IGL02878:Ube3b APN 5 114,542,778 (GRCm39) splice site probably null
IGL02881:Ube3b APN 5 114,550,945 (GRCm39) missense possibly damaging 0.78
R0003:Ube3b UTSW 5 114,536,912 (GRCm39) missense probably benign 0.17
R0071:Ube3b UTSW 5 114,557,558 (GRCm39) missense probably damaging 1.00
R0071:Ube3b UTSW 5 114,557,558 (GRCm39) missense probably damaging 1.00
R0076:Ube3b UTSW 5 114,546,278 (GRCm39) critical splice donor site probably null
R0076:Ube3b UTSW 5 114,546,278 (GRCm39) critical splice donor site probably null
R0111:Ube3b UTSW 5 114,528,437 (GRCm39) splice site probably benign
R0309:Ube3b UTSW 5 114,557,530 (GRCm39) splice site probably benign
R0718:Ube3b UTSW 5 114,540,616 (GRCm39) nonsense probably null
R1344:Ube3b UTSW 5 114,556,636 (GRCm39) missense probably damaging 1.00
R1350:Ube3b UTSW 5 114,544,198 (GRCm39) splice site probably null
R1418:Ube3b UTSW 5 114,556,636 (GRCm39) missense probably damaging 1.00
R1732:Ube3b UTSW 5 114,525,506 (GRCm39) missense probably benign 0.01
R1764:Ube3b UTSW 5 114,542,678 (GRCm39) missense possibly damaging 0.89
R1975:Ube3b UTSW 5 114,537,926 (GRCm39) missense possibly damaging 0.80
R2014:Ube3b UTSW 5 114,549,210 (GRCm39) missense probably damaging 1.00
R2015:Ube3b UTSW 5 114,549,210 (GRCm39) missense probably damaging 1.00
R2041:Ube3b UTSW 5 114,525,294 (GRCm39) missense probably damaging 0.99
R2074:Ube3b UTSW 5 114,553,316 (GRCm39) missense probably benign 0.14
R2202:Ube3b UTSW 5 114,527,135 (GRCm39) missense probably damaging 1.00
R2205:Ube3b UTSW 5 114,527,135 (GRCm39) missense probably damaging 1.00
R3826:Ube3b UTSW 5 114,538,012 (GRCm39) missense probably damaging 0.99
R3829:Ube3b UTSW 5 114,538,012 (GRCm39) missense probably damaging 0.99
R3830:Ube3b UTSW 5 114,538,012 (GRCm39) missense probably damaging 0.99
R3927:Ube3b UTSW 5 114,553,741 (GRCm39) missense probably benign 0.03
R3974:Ube3b UTSW 5 114,550,491 (GRCm39) missense probably benign 0.05
R4096:Ube3b UTSW 5 114,531,147 (GRCm39) missense possibly damaging 0.65
R4261:Ube3b UTSW 5 114,536,489 (GRCm39) missense possibly damaging 0.80
R4415:Ube3b UTSW 5 114,550,505 (GRCm39) missense probably damaging 1.00
R4688:Ube3b UTSW 5 114,531,139 (GRCm39) missense probably benign 0.03
R4779:Ube3b UTSW 5 114,542,778 (GRCm39) splice site probably null
R4824:Ube3b UTSW 5 114,553,787 (GRCm39) splice site probably null
R4868:Ube3b UTSW 5 114,536,488 (GRCm39) missense probably benign 0.00
R4953:Ube3b UTSW 5 114,539,471 (GRCm39) missense probably benign 0.01
R5013:Ube3b UTSW 5 114,545,702 (GRCm39) missense probably damaging 1.00
R5057:Ube3b UTSW 5 114,544,318 (GRCm39) missense probably benign 0.01
R5117:Ube3b UTSW 5 114,557,692 (GRCm39) missense probably damaging 0.96
R5131:Ube3b UTSW 5 114,545,607 (GRCm39) missense probably damaging 1.00
R5498:Ube3b UTSW 5 114,556,635 (GRCm39) missense probably damaging 1.00
R5564:Ube3b UTSW 5 114,527,136 (GRCm39) missense probably damaging 1.00
R5572:Ube3b UTSW 5 114,544,240 (GRCm39) missense probably damaging 0.99
R5580:Ube3b UTSW 5 114,553,384 (GRCm39) missense probably benign
R5596:Ube3b UTSW 5 114,544,221 (GRCm39) splice site probably null
R5843:Ube3b UTSW 5 114,550,360 (GRCm39) missense probably damaging 1.00
R5910:Ube3b UTSW 5 114,553,370 (GRCm39) missense possibly damaging 0.63
R6591:Ube3b UTSW 5 114,546,185 (GRCm39) missense probably benign 0.00
R6691:Ube3b UTSW 5 114,546,185 (GRCm39) missense probably benign 0.00
R7148:Ube3b UTSW 5 114,544,313 (GRCm39) missense probably damaging 0.97
R7334:Ube3b UTSW 5 114,553,742 (GRCm39) missense possibly damaging 0.64
R7438:Ube3b UTSW 5 114,556,687 (GRCm39) missense probably damaging 1.00
R7438:Ube3b UTSW 5 114,553,345 (GRCm39) missense possibly damaging 0.79
R7640:Ube3b UTSW 5 114,553,384 (GRCm39) missense probably benign
R7825:Ube3b UTSW 5 114,539,373 (GRCm39) missense probably damaging 1.00
R7958:Ube3b UTSW 5 114,539,484 (GRCm39) missense probably benign 0.05
R8025:Ube3b UTSW 5 114,546,270 (GRCm39) missense probably damaging 0.99
R8058:Ube3b UTSW 5 114,544,846 (GRCm39) missense possibly damaging 0.58
R8087:Ube3b UTSW 5 114,550,550 (GRCm39) critical splice donor site probably null
R8182:Ube3b UTSW 5 114,530,199 (GRCm39) missense possibly damaging 0.77
R8322:Ube3b UTSW 5 114,540,747 (GRCm39) missense probably benign 0.04
R8465:Ube3b UTSW 5 114,528,451 (GRCm39) missense probably damaging 1.00
R8682:Ube3b UTSW 5 114,550,351 (GRCm39) missense probably damaging 1.00
R8708:Ube3b UTSW 5 114,531,151 (GRCm39) missense probably benign 0.34
R8758:Ube3b UTSW 5 114,553,261 (GRCm39) critical splice acceptor site probably benign
R8784:Ube3b UTSW 5 114,526,800 (GRCm39) missense probably damaging 1.00
R9058:Ube3b UTSW 5 114,553,300 (GRCm39) missense probably benign 0.05
R9072:Ube3b UTSW 5 114,542,607 (GRCm39) missense probably damaging 0.98
R9116:Ube3b UTSW 5 114,542,837 (GRCm39) intron probably benign
R9537:Ube3b UTSW 5 114,525,245 (GRCm39) missense probably damaging 1.00
R9596:Ube3b UTSW 5 114,527,171 (GRCm39) missense probably damaging 1.00
R9632:Ube3b UTSW 5 114,553,370 (GRCm39) missense probably benign 0.00
R9710:Ube3b UTSW 5 114,553,370 (GRCm39) missense probably benign 0.00
X0017:Ube3b UTSW 5 114,553,646 (GRCm39) missense possibly damaging 0.77
Predicted Primers PCR Primer
(F):5'- CAGCAGCCTCAGTGCAAATG -3'
(R):5'- GCGAAGAGTAAGCCATCCAC -3'

Sequencing Primer
(F):5'- GAGAAATCTTTCCTACTGATCGCAGG -3'
(R):5'- TCTATCCTATGAACTGTAACCAGG -3'
Posted On 2015-04-30