Incidental Mutation 'R4049:Herc3'
ID314032
Institutional Source Beutler Lab
Gene Symbol Herc3
Ensembl Gene ENSMUSG00000029804
Gene Namehect domain and RLD 3
Synonyms5730409F18Rik
MMRRC Submission 041616-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4049 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location58831465-58920398 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 58876837 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 623 (I623V)
Ref Sequence ENSEMBL: ENSMUSP00000040025 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031823] [ENSMUST00000041401]
Predicted Effect probably damaging
Transcript: ENSMUST00000031823
AA Change: I623V

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000031823
Gene: ENSMUSG00000029804
AA Change: I623V

DomainStartEndE-ValueType
Pfam:RCC1_2 36 65 3.3e-11 PFAM
Pfam:RCC1 52 99 3.6e-15 PFAM
Pfam:RCC1_2 86 115 1.1e-10 PFAM
Pfam:RCC1 102 152 1.4e-16 PFAM
Pfam:RCC1_2 139 168 2.1e-9 PFAM
Pfam:RCC1 155 205 2.6e-16 PFAM
Pfam:RCC1_2 193 221 1.5e-9 PFAM
Pfam:RCC1 208 257 4.7e-17 PFAM
Pfam:RCC1_2 244 273 8e-9 PFAM
Pfam:RCC1 260 309 2.6e-16 PFAM
Pfam:RCC1_2 296 326 2.3e-7 PFAM
Pfam:RCC1 313 377 3.8e-9 PFAM
HECTc 721 913 2.08e-12 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000041401
AA Change: I623V

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000040025
Gene: ENSMUSG00000029804
AA Change: I623V

DomainStartEndE-ValueType
Pfam:RCC1_2 36 65 1.7e-11 PFAM
Pfam:RCC1 52 99 1.6e-15 PFAM
Pfam:RCC1_2 86 115 1.1e-10 PFAM
Pfam:RCC1 102 152 7.3e-16 PFAM
Pfam:RCC1_2 139 168 1.3e-9 PFAM
Pfam:RCC1 155 205 1.4e-16 PFAM
Pfam:RCC1_2 193 221 5e-10 PFAM
Pfam:RCC1 208 257 1.4e-16 PFAM
Pfam:RCC1_2 244 273 6.1e-8 PFAM
Pfam:RCC1 260 309 1.7e-14 PFAM
Pfam:RCC1_2 296 326 1.1e-7 PFAM
Pfam:RCC1 313 377 6.6e-11 PFAM
HECTc 721 1050 5.79e-157 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000122908
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154290
Predicted Effect noncoding transcript
Transcript: ENSMUST00000204196
Meta Mutation Damage Score 0.0918 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.6%
Validation Efficiency 100% (65/65)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member the HERC ubiquitin ligase family. The encoded protein is located in the cytosol and binds ubiquitin via a HECT domain. Mutations in this gene have been associated with colorectal and gastric carcinomas. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Oct 2012]
PHENOTYPE: Mice homozygous for a null allele exhibit abnormal hair follicle bulge morphology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb5 T A 12: 118,868,669 E1190V probably damaging Het
Arhgef10 A G 8: 14,979,998 T928A probably benign Het
Arhgef10l T A 4: 140,515,451 I836F probably benign Het
Blm T A 7: 80,502,862 T446S probably benign Het
Ccdc63 T A 5: 122,122,750 Q237L probably damaging Het
Cep57l1 G T 10: 41,729,360 R130S probably damaging Het
Clstn2 T G 9: 97,457,560 E786A possibly damaging Het
Col16a1 C T 4: 130,068,752 P540L probably damaging Het
Csf2 A G 11: 54,249,333 F61L probably damaging Het
Ctr9 C T 7: 111,055,543 R1094C unknown Het
Cyp3a41a A G 5: 145,713,540 C98R probably damaging Het
Dthd1 T A 5: 62,827,165 C404* probably null Het
Egfem1 A C 3: 29,686,731 H518P probably benign Het
Elf3 T C 1: 135,254,277 S369G probably benign Het
Eml6 C T 11: 29,838,577 V503M probably damaging Het
Enthd1 T C 15: 80,560,039 D105G probably damaging Het
Eral1 A G 11: 78,075,602 L250P probably damaging Het
Gdf15 A T 8: 70,629,955 M167K probably benign Het
Ggps1 T C 13: 14,053,699 K300E probably benign Het
Gm8074 G A 9: 78,322,336 noncoding transcript Het
Mad1l1 A G 5: 140,132,816 S457P probably damaging Het
Map1lc3a G T 2: 155,277,542 V91F possibly damaging Het
Map4k3 A G 17: 80,605,965 V617A probably benign Het
Mov10l1 T A 15: 88,995,032 probably benign Het
Mroh2a A G 1: 88,258,664 S64G probably benign Het
Ncor1 G T 11: 62,329,668 probably null Het
Nfe2 C T 15: 103,250,937 E36K possibly damaging Het
Olfr1176 T C 2: 88,343,800 probably null Het
Olfr1212 A G 2: 88,959,273 K269R probably benign Het
Olfr1251 T C 2: 89,667,662 I75V probably benign Het
Olfr653 T C 7: 104,580,368 F241L probably benign Het
Oprm1 G A 10: 6,829,087 V95I probably benign Het
Pcdha9 T A 18: 36,997,942 H21Q probably benign Het
Pcolce2 A T 9: 95,638,755 I62F probably damaging Het
Pfpl T A 19: 12,429,689 C435S probably damaging Het
Pkhd1l1 G A 15: 44,498,557 C542Y probably damaging Het
Plekha5 T C 6: 140,583,871 S75P probably damaging Het
Pphln1 C A 15: 93,465,106 A202E probably damaging Het
Ppp1r1a A G 15: 103,532,454 L92P probably damaging Het
Prokr2 T C 2: 132,381,494 T43A probably benign Het
Rai14 T C 15: 10,592,212 N199S probably benign Het
Rasgrp2 T C 19: 6,404,727 L199P probably damaging Het
Rnf213 A C 11: 119,482,448 M4939L possibly damaging Het
Slc23a2 C T 2: 132,060,683 R533Q probably benign Het
Slc7a7 T C 14: 54,373,091 probably null Het
Snrpd2 T A 7: 19,151,307 V31E probably damaging Het
Spire1 G T 18: 67,529,031 probably null Het
Srsf4 T C 4: 131,900,543 probably benign Het
Tcf20 A G 15: 82,853,429 S1274P probably damaging Het
Tcof1 C A 18: 60,832,903 A376S possibly damaging Het
Thsd1 T A 8: 22,243,164 Y76N possibly damaging Het
Timm44 A G 8: 4,260,561 V397A probably benign Het
Tmc6 G A 11: 117,778,261 T89I possibly damaging Het
Trbv31 C A 6: 41,557,705 C107F probably damaging Het
Trim37 T A 11: 87,140,603 probably null Het
Ttll5 T C 12: 86,012,799 V1226A probably benign Het
Ube3b T C 5: 114,412,870 V865A probably benign Het
Vmn2r86 A T 10: 130,447,097 M550K probably damaging Het
Vps54 C A 11: 21,300,183 T373N probably benign Het
Wdr64 T G 1: 175,805,856 I891S probably benign Het
Wisp2 A G 2: 163,828,984 D137G probably damaging Het
Zfhx4 C T 3: 5,398,859 S1384L probably damaging Het
Zfp703 A G 8: 26,979,085 E259G possibly damaging Het
Zfp933 T C 4: 147,826,512 H209R probably damaging Het
Zfp980 A G 4: 145,702,600 H633R probably damaging Het
Other mutations in Herc3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00228:Herc3 APN 6 58874263 missense probably damaging 1.00
IGL00423:Herc3 APN 6 58868715 missense probably damaging 0.99
IGL00468:Herc3 APN 6 58918766 missense probably benign 0.04
IGL01153:Herc3 APN 6 58860336 missense probably benign 0.21
IGL01468:Herc3 APN 6 58854895 missense probably benign 0.00
IGL01696:Herc3 APN 6 58860386 missense possibly damaging 0.58
IGL01975:Herc3 APN 6 58916576 missense possibly damaging 0.91
IGL02797:Herc3 APN 6 58868694 missense probably benign
IGL02953:Herc3 APN 6 58857733 nonsense probably null
aegean UTSW 6 58855760 nonsense probably null
PIT4519001:Herc3 UTSW 6 58876811 missense probably damaging 1.00
R0019:Herc3 UTSW 6 58885065 splice site probably benign
R0019:Herc3 UTSW 6 58885065 splice site probably benign
R0025:Herc3 UTSW 6 58874308 missense probably damaging 1.00
R0025:Herc3 UTSW 6 58874308 missense probably damaging 1.00
R0268:Herc3 UTSW 6 58868628 splice site probably benign
R0334:Herc3 UTSW 6 58918817 missense probably damaging 1.00
R0344:Herc3 UTSW 6 58868628 splice site probably benign
R0853:Herc3 UTSW 6 58876564 missense probably damaging 1.00
R0927:Herc3 UTSW 6 58868763 missense possibly damaging 0.48
R1333:Herc3 UTSW 6 58887493 missense probably damaging 1.00
R1432:Herc3 UTSW 6 58916842 missense possibly damaging 0.49
R1450:Herc3 UTSW 6 58876515 nonsense probably null
R1594:Herc3 UTSW 6 58887584 unclassified probably benign
R1757:Herc3 UTSW 6 58916470 missense probably damaging 1.00
R1765:Herc3 UTSW 6 58888660 missense probably damaging 0.99
R1932:Herc3 UTSW 6 58876793 missense probably damaging 0.99
R1945:Herc3 UTSW 6 58887439 missense probably damaging 0.96
R1988:Herc3 UTSW 6 58884975 critical splice donor site probably null
R2172:Herc3 UTSW 6 58887437 missense probably damaging 1.00
R3080:Herc3 UTSW 6 58856646 unclassified probably null
R3545:Herc3 UTSW 6 58856685 missense probably damaging 1.00
R3767:Herc3 UTSW 6 58862988 missense probably benign
R3767:Herc3 UTSW 6 58876602 missense probably benign 0.00
R3805:Herc3 UTSW 6 58916850 missense probably damaging 1.00
R3806:Herc3 UTSW 6 58916850 missense probably damaging 1.00
R4250:Herc3 UTSW 6 58916516 missense probably damaging 1.00
R4469:Herc3 UTSW 6 58876809 nonsense probably null
R4534:Herc3 UTSW 6 58860347 missense probably benign
R4573:Herc3 UTSW 6 58894113 missense possibly damaging 0.89
R4887:Herc3 UTSW 6 58887499 missense probably damaging 1.00
R5047:Herc3 UTSW 6 58855760 nonsense probably null
R5049:Herc3 UTSW 6 58894539 splice site probably null
R5062:Herc3 UTSW 6 58855760 nonsense probably null
R5063:Herc3 UTSW 6 58855760 nonsense probably null
R5288:Herc3 UTSW 6 58874278 missense probably damaging 0.99
R5297:Herc3 UTSW 6 58856641 missense probably damaging 1.00
R5386:Herc3 UTSW 6 58874278 missense probably damaging 0.99
R5435:Herc3 UTSW 6 58855806 missense probably damaging 1.00
R5576:Herc3 UTSW 6 58888725 missense probably benign 0.08
R5605:Herc3 UTSW 6 58857727 missense probably damaging 1.00
R5719:Herc3 UTSW 6 58894543 missense possibly damaging 0.67
R5743:Herc3 UTSW 6 58918799 missense probably benign 0.12
R5870:Herc3 UTSW 6 58916450 missense probably benign 0.01
R6460:Herc3 UTSW 6 58890123 missense probably damaging 1.00
R6930:Herc3 UTSW 6 58916459 missense probably damaging 0.98
R7034:Herc3 UTSW 6 58876855 missense probably benign 0.00
R7131:Herc3 UTSW 6 58887424 missense probably damaging 1.00
R7187:Herc3 UTSW 6 58856631 missense probably benign 0.42
R7212:Herc3 UTSW 6 58918773 missense probably damaging 1.00
R7335:Herc3 UTSW 6 58876788 missense possibly damaging 0.95
R7349:Herc3 UTSW 6 58858986 missense probably benign
R7568:Herc3 UTSW 6 58843810 missense probably benign 0.01
R7857:Herc3 UTSW 6 58843652 nonsense probably null
R7940:Herc3 UTSW 6 58843652 nonsense probably null
Z1176:Herc3 UTSW 6 58843858 nonsense probably null
Predicted Primers PCR Primer
(F):5'- ATCCCGGTACTGTTTAACAACTAC -3'
(R):5'- GGTGTGTTAGCAGCATTCAAG -3'

Sequencing Primer
(F):5'- TCTGGAGAAGTTGTACAAGGTATCCC -3'
(R):5'- TGTGTTAGCAGCATTCAAGCCAAAG -3'
Posted On2015-04-30