Incidental Mutation 'R4049:Herc3'
ID 314032
Institutional Source Beutler Lab
Gene Symbol Herc3
Ensembl Gene ENSMUSG00000029804
Gene Name hect domain and RLD 3
Synonyms 5730409F18Rik
MMRRC Submission 041616-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R4049 (G1)
Quality Score 225
Status Validated
Chromosome 6
Chromosomal Location 58808450-58897383 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 58853822 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Valine at position 623 (I623V)
Ref Sequence ENSEMBL: ENSMUSP00000040025 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031823] [ENSMUST00000041401]
AlphaFold A6H6S0
Predicted Effect probably damaging
Transcript: ENSMUST00000031823
AA Change: I623V

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000031823
Gene: ENSMUSG00000029804
AA Change: I623V

DomainStartEndE-ValueType
Pfam:RCC1_2 36 65 3.3e-11 PFAM
Pfam:RCC1 52 99 3.6e-15 PFAM
Pfam:RCC1_2 86 115 1.1e-10 PFAM
Pfam:RCC1 102 152 1.4e-16 PFAM
Pfam:RCC1_2 139 168 2.1e-9 PFAM
Pfam:RCC1 155 205 2.6e-16 PFAM
Pfam:RCC1_2 193 221 1.5e-9 PFAM
Pfam:RCC1 208 257 4.7e-17 PFAM
Pfam:RCC1_2 244 273 8e-9 PFAM
Pfam:RCC1 260 309 2.6e-16 PFAM
Pfam:RCC1_2 296 326 2.3e-7 PFAM
Pfam:RCC1 313 377 3.8e-9 PFAM
HECTc 721 913 2.08e-12 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000041401
AA Change: I623V

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000040025
Gene: ENSMUSG00000029804
AA Change: I623V

DomainStartEndE-ValueType
Pfam:RCC1_2 36 65 1.7e-11 PFAM
Pfam:RCC1 52 99 1.6e-15 PFAM
Pfam:RCC1_2 86 115 1.1e-10 PFAM
Pfam:RCC1 102 152 7.3e-16 PFAM
Pfam:RCC1_2 139 168 1.3e-9 PFAM
Pfam:RCC1 155 205 1.4e-16 PFAM
Pfam:RCC1_2 193 221 5e-10 PFAM
Pfam:RCC1 208 257 1.4e-16 PFAM
Pfam:RCC1_2 244 273 6.1e-8 PFAM
Pfam:RCC1 260 309 1.7e-14 PFAM
Pfam:RCC1_2 296 326 1.1e-7 PFAM
Pfam:RCC1 313 377 6.6e-11 PFAM
HECTc 721 1050 5.79e-157 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000122908
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154290
Predicted Effect noncoding transcript
Transcript: ENSMUST00000204196
Meta Mutation Damage Score 0.0918 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.6%
Validation Efficiency 100% (65/65)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member the HERC ubiquitin ligase family. The encoded protein is located in the cytosol and binds ubiquitin via a HECT domain. Mutations in this gene have been associated with colorectal and gastric carcinomas. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Oct 2012]
PHENOTYPE: Mice homozygous for a null allele exhibit abnormal hair follicle bulge morphology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb5 T A 12: 118,832,404 (GRCm39) E1190V probably damaging Het
Arhgef10 A G 8: 15,029,998 (GRCm39) T928A probably benign Het
Arhgef10l T A 4: 140,242,762 (GRCm39) I836F probably benign Het
Blm T A 7: 80,152,610 (GRCm39) T446S probably benign Het
Ccdc63 T A 5: 122,260,813 (GRCm39) Q237L probably damaging Het
Ccn5 A G 2: 163,670,904 (GRCm39) D137G probably damaging Het
Cep57l1 G T 10: 41,605,356 (GRCm39) R130S probably damaging Het
Clstn2 T G 9: 97,339,613 (GRCm39) E786A possibly damaging Het
Col16a1 C T 4: 129,962,545 (GRCm39) P540L probably damaging Het
Csf2 A G 11: 54,140,159 (GRCm39) F61L probably damaging Het
Ctr9 C T 7: 110,654,750 (GRCm39) R1094C unknown Het
Cyp3a41a A G 5: 145,650,350 (GRCm39) C98R probably damaging Het
Dthd1 T A 5: 62,984,508 (GRCm39) C404* probably null Het
Egfem1 A C 3: 29,740,880 (GRCm39) H518P probably benign Het
Elf3 T C 1: 135,182,015 (GRCm39) S369G probably benign Het
Eml6 C T 11: 29,788,577 (GRCm39) V503M probably damaging Het
Enthd1 T C 15: 80,444,240 (GRCm39) D105G probably damaging Het
Eral1 A G 11: 77,966,428 (GRCm39) L250P probably damaging Het
Gdf15 A T 8: 71,082,605 (GRCm39) M167K probably benign Het
Ggps1 T C 13: 14,228,284 (GRCm39) K300E probably benign Het
Gm8074 G A 9: 78,229,618 (GRCm39) noncoding transcript Het
Mad1l1 A G 5: 140,118,571 (GRCm39) S457P probably damaging Het
Map1lc3a G T 2: 155,119,462 (GRCm39) V91F possibly damaging Het
Map4k3 A G 17: 80,913,394 (GRCm39) V617A probably benign Het
Mov10l1 T A 15: 88,879,235 (GRCm39) probably benign Het
Mroh2a A G 1: 88,186,386 (GRCm39) S64G probably benign Het
Ncor1 G T 11: 62,220,494 (GRCm39) probably null Het
Nfe2 C T 15: 103,159,364 (GRCm39) E36K possibly damaging Het
Oprm1 G A 10: 6,779,087 (GRCm39) V95I probably benign Het
Or4a78 T C 2: 89,498,006 (GRCm39) I75V probably benign Het
Or4c107 A G 2: 88,789,617 (GRCm39) K269R probably benign Het
Or52d3 T C 7: 104,229,575 (GRCm39) F241L probably benign Het
Or5d46 T C 2: 88,174,144 (GRCm39) probably null Het
Pcdha9 T A 18: 37,130,995 (GRCm39) H21Q probably benign Het
Pcolce2 A T 9: 95,520,808 (GRCm39) I62F probably damaging Het
Pfpl T A 19: 12,407,053 (GRCm39) C435S probably damaging Het
Pkhd1l1 G A 15: 44,361,953 (GRCm39) C542Y probably damaging Het
Plekha5 T C 6: 140,529,597 (GRCm39) S75P probably damaging Het
Pphln1 C A 15: 93,362,987 (GRCm39) A202E probably damaging Het
Ppp1r1a A G 15: 103,440,881 (GRCm39) L92P probably damaging Het
Prokr2 T C 2: 132,223,414 (GRCm39) T43A probably benign Het
Rai14 T C 15: 10,592,298 (GRCm39) N199S probably benign Het
Rasgrp2 T C 19: 6,454,757 (GRCm39) L199P probably damaging Het
Rnf213 A C 11: 119,373,274 (GRCm39) M4939L possibly damaging Het
Slc23a2 C T 2: 131,902,603 (GRCm39) R533Q probably benign Het
Slc7a7 T C 14: 54,610,548 (GRCm39) probably null Het
Snrpd2 T A 7: 18,885,232 (GRCm39) V31E probably damaging Het
Spire1 G T 18: 67,662,101 (GRCm39) probably null Het
Srsf4 T C 4: 131,627,854 (GRCm39) probably benign Het
Tcf20 A G 15: 82,737,630 (GRCm39) S1274P probably damaging Het
Tcof1 C A 18: 60,965,975 (GRCm39) A376S possibly damaging Het
Thsd1 T A 8: 22,733,180 (GRCm39) Y76N possibly damaging Het
Timm44 A G 8: 4,310,561 (GRCm39) V397A probably benign Het
Tmc6 G A 11: 117,669,087 (GRCm39) T89I possibly damaging Het
Trbv31 C A 6: 41,534,639 (GRCm39) C107F probably damaging Het
Trim37 T A 11: 87,031,429 (GRCm39) probably null Het
Ttll5 T C 12: 86,059,573 (GRCm39) V1226A probably benign Het
Ube3b T C 5: 114,550,931 (GRCm39) V865A probably benign Het
Vmn2r86 A T 10: 130,282,966 (GRCm39) M550K probably damaging Het
Vps54 C A 11: 21,250,183 (GRCm39) T373N probably benign Het
Wdr64 T G 1: 175,633,422 (GRCm39) I891S probably benign Het
Zfhx4 C T 3: 5,463,919 (GRCm39) S1384L probably damaging Het
Zfp703 A G 8: 27,469,113 (GRCm39) E259G possibly damaging Het
Zfp933 T C 4: 147,910,969 (GRCm39) H209R probably damaging Het
Zfp980 A G 4: 145,429,170 (GRCm39) H633R probably damaging Het
Other mutations in Herc3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00228:Herc3 APN 6 58,851,248 (GRCm39) missense probably damaging 1.00
IGL00423:Herc3 APN 6 58,845,700 (GRCm39) missense probably damaging 0.99
IGL00468:Herc3 APN 6 58,895,751 (GRCm39) missense probably benign 0.04
IGL01153:Herc3 APN 6 58,837,321 (GRCm39) missense probably benign 0.21
IGL01468:Herc3 APN 6 58,831,880 (GRCm39) missense probably benign 0.00
IGL01696:Herc3 APN 6 58,837,371 (GRCm39) missense possibly damaging 0.58
IGL01975:Herc3 APN 6 58,893,561 (GRCm39) missense possibly damaging 0.91
IGL02797:Herc3 APN 6 58,845,679 (GRCm39) missense probably benign
IGL02953:Herc3 APN 6 58,834,718 (GRCm39) nonsense probably null
aegean UTSW 6 58,832,745 (GRCm39) nonsense probably null
PIT4519001:Herc3 UTSW 6 58,853,796 (GRCm39) missense probably damaging 1.00
R0019:Herc3 UTSW 6 58,862,050 (GRCm39) splice site probably benign
R0019:Herc3 UTSW 6 58,862,050 (GRCm39) splice site probably benign
R0025:Herc3 UTSW 6 58,851,293 (GRCm39) missense probably damaging 1.00
R0025:Herc3 UTSW 6 58,851,293 (GRCm39) missense probably damaging 1.00
R0268:Herc3 UTSW 6 58,845,613 (GRCm39) splice site probably benign
R0334:Herc3 UTSW 6 58,895,802 (GRCm39) missense probably damaging 1.00
R0344:Herc3 UTSW 6 58,845,613 (GRCm39) splice site probably benign
R0853:Herc3 UTSW 6 58,853,549 (GRCm39) missense probably damaging 1.00
R0927:Herc3 UTSW 6 58,845,748 (GRCm39) missense possibly damaging 0.48
R1333:Herc3 UTSW 6 58,864,478 (GRCm39) missense probably damaging 1.00
R1432:Herc3 UTSW 6 58,893,827 (GRCm39) missense possibly damaging 0.49
R1450:Herc3 UTSW 6 58,853,500 (GRCm39) nonsense probably null
R1594:Herc3 UTSW 6 58,864,569 (GRCm39) unclassified probably benign
R1757:Herc3 UTSW 6 58,893,455 (GRCm39) missense probably damaging 1.00
R1765:Herc3 UTSW 6 58,865,645 (GRCm39) missense probably damaging 0.99
R1932:Herc3 UTSW 6 58,853,778 (GRCm39) missense probably damaging 0.99
R1945:Herc3 UTSW 6 58,864,424 (GRCm39) missense probably damaging 0.96
R1988:Herc3 UTSW 6 58,861,960 (GRCm39) critical splice donor site probably null
R2172:Herc3 UTSW 6 58,864,422 (GRCm39) missense probably damaging 1.00
R3080:Herc3 UTSW 6 58,833,631 (GRCm39) splice site probably null
R3545:Herc3 UTSW 6 58,833,670 (GRCm39) missense probably damaging 1.00
R3767:Herc3 UTSW 6 58,853,587 (GRCm39) missense probably benign 0.00
R3767:Herc3 UTSW 6 58,839,973 (GRCm39) missense probably benign
R3805:Herc3 UTSW 6 58,893,835 (GRCm39) missense probably damaging 1.00
R3806:Herc3 UTSW 6 58,893,835 (GRCm39) missense probably damaging 1.00
R4250:Herc3 UTSW 6 58,893,501 (GRCm39) missense probably damaging 1.00
R4469:Herc3 UTSW 6 58,853,794 (GRCm39) nonsense probably null
R4534:Herc3 UTSW 6 58,837,332 (GRCm39) missense probably benign
R4573:Herc3 UTSW 6 58,871,098 (GRCm39) missense possibly damaging 0.89
R4887:Herc3 UTSW 6 58,864,484 (GRCm39) missense probably damaging 1.00
R5047:Herc3 UTSW 6 58,832,745 (GRCm39) nonsense probably null
R5049:Herc3 UTSW 6 58,871,524 (GRCm39) splice site probably null
R5062:Herc3 UTSW 6 58,832,745 (GRCm39) nonsense probably null
R5063:Herc3 UTSW 6 58,832,745 (GRCm39) nonsense probably null
R5288:Herc3 UTSW 6 58,851,263 (GRCm39) missense probably damaging 0.99
R5297:Herc3 UTSW 6 58,833,626 (GRCm39) missense probably damaging 1.00
R5386:Herc3 UTSW 6 58,851,263 (GRCm39) missense probably damaging 0.99
R5435:Herc3 UTSW 6 58,832,791 (GRCm39) missense probably damaging 1.00
R5576:Herc3 UTSW 6 58,865,710 (GRCm39) missense probably benign 0.08
R5605:Herc3 UTSW 6 58,834,712 (GRCm39) missense probably damaging 1.00
R5719:Herc3 UTSW 6 58,871,528 (GRCm39) missense possibly damaging 0.67
R5743:Herc3 UTSW 6 58,895,784 (GRCm39) missense probably benign 0.12
R5870:Herc3 UTSW 6 58,893,435 (GRCm39) missense probably benign 0.01
R6460:Herc3 UTSW 6 58,867,108 (GRCm39) missense probably damaging 1.00
R6930:Herc3 UTSW 6 58,893,444 (GRCm39) missense probably damaging 0.98
R7034:Herc3 UTSW 6 58,853,840 (GRCm39) missense probably benign 0.00
R7131:Herc3 UTSW 6 58,864,409 (GRCm39) missense probably damaging 1.00
R7187:Herc3 UTSW 6 58,833,616 (GRCm39) missense probably benign 0.42
R7212:Herc3 UTSW 6 58,895,758 (GRCm39) missense probably damaging 1.00
R7335:Herc3 UTSW 6 58,853,773 (GRCm39) missense possibly damaging 0.95
R7349:Herc3 UTSW 6 58,835,971 (GRCm39) missense probably benign
R7568:Herc3 UTSW 6 58,820,795 (GRCm39) missense probably benign 0.01
R7857:Herc3 UTSW 6 58,820,637 (GRCm39) nonsense probably null
R8321:Herc3 UTSW 6 58,820,754 (GRCm39) missense possibly damaging 0.93
R8672:Herc3 UTSW 6 58,850,786 (GRCm39) missense probably damaging 0.96
R8684:Herc3 UTSW 6 58,864,561 (GRCm39) missense probably damaging 1.00
R8968:Herc3 UTSW 6 58,867,183 (GRCm39) missense probably damaging 1.00
R8994:Herc3 UTSW 6 58,851,328 (GRCm39) missense probably benign 0.11
R9219:Herc3 UTSW 6 58,871,552 (GRCm39) missense probably benign 0.01
R9434:Herc3 UTSW 6 58,853,846 (GRCm39) missense probably benign 0.00
R9562:Herc3 UTSW 6 58,835,999 (GRCm39) missense probably null 0.01
R9565:Herc3 UTSW 6 58,835,999 (GRCm39) missense probably null 0.01
Z1176:Herc3 UTSW 6 58,820,843 (GRCm39) nonsense probably null
Predicted Primers PCR Primer
(F):5'- ATCCCGGTACTGTTTAACAACTAC -3'
(R):5'- GGTGTGTTAGCAGCATTCAAG -3'

Sequencing Primer
(F):5'- TCTGGAGAAGTTGTACAAGGTATCCC -3'
(R):5'- TGTGTTAGCAGCATTCAAGCCAAAG -3'
Posted On 2015-04-30