Incidental Mutation 'R4049:Blm'
ID314036
Institutional Source Beutler Lab
Gene Symbol Blm
Ensembl Gene ENSMUSG00000030528
Gene NameBloom syndrome, RecQ like helicase
Synonyms
MMRRC Submission 041616-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4049 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location80454733-80535119 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 80502862 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Serine at position 446 (T446S)
Ref Sequence ENSEMBL: ENSMUSP00000127995 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000081314] [ENSMUST00000170315]
Predicted Effect probably benign
Transcript: ENSMUST00000081314
AA Change: T443S

PolyPhen 2 Score 0.036 (Sensitivity: 0.94; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000080062
Gene: ENSMUSG00000030528
AA Change: T443S

DomainStartEndE-ValueType
low complexity region 46 54 N/A INTRINSIC
low complexity region 118 132 N/A INTRINSIC
low complexity region 142 169 N/A INTRINSIC
low complexity region 219 231 N/A INTRINSIC
low complexity region 318 335 N/A INTRINSIC
Pfam:BDHCT 376 416 5.5e-27 PFAM
low complexity region 557 574 N/A INTRINSIC
DEXDc 672 873 1.59e-29 SMART
HELICc 910 992 1.29e-24 SMART
RQC 1084 1198 1.43e-15 SMART
HRDC 1217 1297 9.4e-20 SMART
low complexity region 1357 1371 N/A INTRINSIC
low complexity region 1378 1392 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000166096
Predicted Effect probably benign
Transcript: ENSMUST00000170315
AA Change: T446S

PolyPhen 2 Score 0.036 (Sensitivity: 0.94; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000127995
Gene: ENSMUSG00000030528
AA Change: T446S

DomainStartEndE-ValueType
Pfam:BLM_N 4 375 1.1e-161 PFAM
Pfam:BDHCT 380 419 6.4e-25 PFAM
Pfam:BDHCT_assoc 433 658 8.8e-108 PFAM
DEXDc 675 876 1.59e-29 SMART
HELICc 913 995 1.29e-24 SMART
Pfam:RecQ_Zn_bind 1006 1078 1.5e-19 PFAM
RQC 1087 1201 1.43e-15 SMART
HRDC 1220 1300 9.4e-20 SMART
low complexity region 1360 1374 N/A INTRINSIC
low complexity region 1381 1395 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205263
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.6%
Validation Efficiency 100% (65/65)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The Bloom syndrome gene product is related to the RecQ subset of DExH box-containing DNA helicases and has both DNA-stimulated ATPase and ATP-dependent DNA helicase activities. Mutations causing Bloom syndrome delete or alter helicase motifs and may disable the 3'-5' helicase activity. The normal protein may act to suppress inappropriate recombination. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mutants are developmentally delayed, with increased apopotosis in the epiblast and severe anemia, dying at embyronic day 13.5; but homozygotes for a cre mediated recombinant allele are viable Bloom syndrome-like mice prone to a wide variety of cancers and showing increased rates of LOH. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb5 T A 12: 118,868,669 E1190V probably damaging Het
Arhgef10 A G 8: 14,979,998 T928A probably benign Het
Arhgef10l T A 4: 140,515,451 I836F probably benign Het
Ccdc63 T A 5: 122,122,750 Q237L probably damaging Het
Cep57l1 G T 10: 41,729,360 R130S probably damaging Het
Clstn2 T G 9: 97,457,560 E786A possibly damaging Het
Col16a1 C T 4: 130,068,752 P540L probably damaging Het
Csf2 A G 11: 54,249,333 F61L probably damaging Het
Ctr9 C T 7: 111,055,543 R1094C unknown Het
Cyp3a41a A G 5: 145,713,540 C98R probably damaging Het
Dthd1 T A 5: 62,827,165 C404* probably null Het
Egfem1 A C 3: 29,686,731 H518P probably benign Het
Elf3 T C 1: 135,254,277 S369G probably benign Het
Eml6 C T 11: 29,838,577 V503M probably damaging Het
Enthd1 T C 15: 80,560,039 D105G probably damaging Het
Eral1 A G 11: 78,075,602 L250P probably damaging Het
Gdf15 A T 8: 70,629,955 M167K probably benign Het
Ggps1 T C 13: 14,053,699 K300E probably benign Het
Gm8074 G A 9: 78,322,336 noncoding transcript Het
Herc3 A G 6: 58,876,837 I623V probably damaging Het
Mad1l1 A G 5: 140,132,816 S457P probably damaging Het
Map1lc3a G T 2: 155,277,542 V91F possibly damaging Het
Map4k3 A G 17: 80,605,965 V617A probably benign Het
Mov10l1 T A 15: 88,995,032 probably benign Het
Mroh2a A G 1: 88,258,664 S64G probably benign Het
Ncor1 G T 11: 62,329,668 probably null Het
Nfe2 C T 15: 103,250,937 E36K possibly damaging Het
Olfr1176 T C 2: 88,343,800 probably null Het
Olfr1212 A G 2: 88,959,273 K269R probably benign Het
Olfr1251 T C 2: 89,667,662 I75V probably benign Het
Olfr653 T C 7: 104,580,368 F241L probably benign Het
Oprm1 G A 10: 6,829,087 V95I probably benign Het
Pcdha9 T A 18: 36,997,942 H21Q probably benign Het
Pcolce2 A T 9: 95,638,755 I62F probably damaging Het
Pfpl T A 19: 12,429,689 C435S probably damaging Het
Pkhd1l1 G A 15: 44,498,557 C542Y probably damaging Het
Plekha5 T C 6: 140,583,871 S75P probably damaging Het
Pphln1 C A 15: 93,465,106 A202E probably damaging Het
Ppp1r1a A G 15: 103,532,454 L92P probably damaging Het
Prokr2 T C 2: 132,381,494 T43A probably benign Het
Rai14 T C 15: 10,592,212 N199S probably benign Het
Rasgrp2 T C 19: 6,404,727 L199P probably damaging Het
Rnf213 A C 11: 119,482,448 M4939L possibly damaging Het
Slc23a2 C T 2: 132,060,683 R533Q probably benign Het
Slc7a7 T C 14: 54,373,091 probably null Het
Snrpd2 T A 7: 19,151,307 V31E probably damaging Het
Spire1 G T 18: 67,529,031 probably null Het
Srsf4 T C 4: 131,900,543 probably benign Het
Tcf20 A G 15: 82,853,429 S1274P probably damaging Het
Tcof1 C A 18: 60,832,903 A376S possibly damaging Het
Thsd1 T A 8: 22,243,164 Y76N possibly damaging Het
Timm44 A G 8: 4,260,561 V397A probably benign Het
Tmc6 G A 11: 117,778,261 T89I possibly damaging Het
Trbv31 C A 6: 41,557,705 C107F probably damaging Het
Trim37 T A 11: 87,140,603 probably null Het
Ttll5 T C 12: 86,012,799 V1226A probably benign Het
Ube3b T C 5: 114,412,870 V865A probably benign Het
Vmn2r86 A T 10: 130,447,097 M550K probably damaging Het
Vps54 C A 11: 21,300,183 T373N probably benign Het
Wdr64 T G 1: 175,805,856 I891S probably benign Het
Wisp2 A G 2: 163,828,984 D137G probably damaging Het
Zfhx4 C T 3: 5,398,859 S1384L probably damaging Het
Zfp703 A G 8: 26,979,085 E259G possibly damaging Het
Zfp933 T C 4: 147,826,512 H209R probably damaging Het
Zfp980 A G 4: 145,702,600 H633R probably damaging Het
Other mutations in Blm
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01531:Blm APN 7 80474071 missense probably damaging 1.00
IGL01658:Blm APN 7 80463941 missense probably damaging 0.98
IGL02048:Blm APN 7 80502961 splice site probably benign
IGL02060:Blm APN 7 80514580 splice site probably benign
IGL02063:Blm APN 7 80509419 nonsense probably null
IGL02102:Blm APN 7 80469756 missense probably damaging 1.00
IGL02420:Blm APN 7 80496006 missense probably damaging 1.00
IGL02452:Blm APN 7 80503377 splice site probably null
IGL02566:Blm APN 7 80474196 missense probably damaging 1.00
IGL03387:Blm APN 7 80494147 missense probably damaging 1.00
FR4304:Blm UTSW 7 80463773 frame shift probably null
FR4304:Blm UTSW 7 80512919 small insertion probably benign
FR4340:Blm UTSW 7 80463767 unclassified probably benign
FR4340:Blm UTSW 7 80512907 small insertion probably benign
FR4340:Blm UTSW 7 80512910 small insertion probably benign
FR4449:Blm UTSW 7 80512908 small insertion probably benign
FR4548:Blm UTSW 7 80463769 frame shift probably null
FR4589:Blm UTSW 7 80463770 frame shift probably null
FR4737:Blm UTSW 7 80463771 frame shift probably null
FR4737:Blm UTSW 7 80463774 frame shift probably null
FR4976:Blm UTSW 7 80463767 unclassified probably benign
FR4976:Blm UTSW 7 80512907 small insertion probably benign
R0133:Blm UTSW 7 80502367 missense possibly damaging 0.93
R0194:Blm UTSW 7 80464946 unclassified probably benign
R0526:Blm UTSW 7 80505893 nonsense probably null
R0673:Blm UTSW 7 80499751 critical splice donor site probably null
R0972:Blm UTSW 7 80513370 missense probably benign
R0980:Blm UTSW 7 80499958 splice site probably null
R1120:Blm UTSW 7 80481466 missense probably damaging 1.00
R1301:Blm UTSW 7 80455417 nonsense probably null
R1769:Blm UTSW 7 80513370 missense probably benign
R1866:Blm UTSW 7 80494114 missense probably benign 0.08
R1874:Blm UTSW 7 80497418 missense probably damaging 1.00
R1966:Blm UTSW 7 80513186 missense possibly damaging 0.86
R1991:Blm UTSW 7 80505949 splice site probably null
R2013:Blm UTSW 7 80502399 missense probably damaging 0.99
R2014:Blm UTSW 7 80502399 missense probably damaging 0.99
R2015:Blm UTSW 7 80502399 missense probably damaging 0.99
R2016:Blm UTSW 7 80505926 missense probably benign 0.26
R2103:Blm UTSW 7 80505949 splice site probably null
R2161:Blm UTSW 7 80481370 splice site probably null
R2215:Blm UTSW 7 80499847 missense possibly damaging 0.69
R3689:Blm UTSW 7 80513079 missense possibly damaging 0.56
R4155:Blm UTSW 7 80512904 small deletion probably benign
R4695:Blm UTSW 7 80494228 missense probably damaging 1.00
R4774:Blm UTSW 7 80463848 missense probably damaging 1.00
R4833:Blm UTSW 7 80466826 missense probably benign
R4835:Blm UTSW 7 80509546 missense probably benign 0.41
R4994:Blm UTSW 7 80458825 missense probably benign 0.00
R5039:Blm UTSW 7 80505873 missense possibly damaging 0.50
R5330:Blm UTSW 7 80458936 missense possibly damaging 0.73
R5375:Blm UTSW 7 80513229 missense probably benign 0.00
R5408:Blm UTSW 7 80502622 missense probably benign 0.01
R5574:Blm UTSW 7 80499773 missense probably damaging 1.00
R5606:Blm UTSW 7 80460832 splice site probably null
R5702:Blm UTSW 7 80458927 missense probably benign 0.13
R5809:Blm UTSW 7 80464844 missense probably damaging 1.00
R6114:Blm UTSW 7 80513487 missense probably damaging 1.00
R6157:Blm UTSW 7 80512985 missense probably benign 0.18
R6163:Blm UTSW 7 80512904 small deletion probably benign
R6254:Blm UTSW 7 80480342 missense probably benign 0.04
R6266:Blm UTSW 7 80499940 missense probably benign 0.03
R6364:Blm UTSW 7 80494526 nonsense probably null
R6446:Blm UTSW 7 80512904 small deletion probably benign
R6502:Blm UTSW 7 80481475 missense probably damaging 0.98
R6700:Blm UTSW 7 80463850 missense possibly damaging 0.91
R7002:Blm UTSW 7 80469753 missense probably benign 0.00
R7105:Blm UTSW 7 80499768 missense probably benign 0.44
R7320:Blm UTSW 7 80455354 nonsense probably null
R7465:Blm UTSW 7 80513115 missense probably benign 0.02
R7561:Blm UTSW 7 80502528 missense probably damaging 0.99
R8500:Blm UTSW 7 80455284 missense probably damaging 1.00
R8543:Blm UTSW 7 80494216 missense probably damaging 0.98
R8749:Blm UTSW 7 80512901 small insertion probably benign
R8774:Blm UTSW 7 80512901 small insertion probably benign
R8774:Blm UTSW 7 80512910 small insertion probably benign
R8774-TAIL:Blm UTSW 7 80512907 small insertion probably benign
R8774-TAIL:Blm UTSW 7 80512918 small insertion probably benign
R8774-TAIL:Blm UTSW 7 80512919 small insertion probably benign
R8775-TAIL:Blm UTSW 7 80512931 small insertion probably benign
RF001:Blm UTSW 7 80512903 small insertion probably benign
RF001:Blm UTSW 7 80512906 small insertion probably benign
RF001:Blm UTSW 7 80512927 small insertion probably benign
RF002:Blm UTSW 7 80512905 small insertion probably benign
RF002:Blm UTSW 7 80512927 small insertion probably benign
RF007:Blm UTSW 7 80512933 nonsense probably null
RF016:Blm UTSW 7 80512926 nonsense probably null
RF018:Blm UTSW 7 80512926 nonsense probably null
RF027:Blm UTSW 7 80512914 frame shift probably null
RF028:Blm UTSW 7 80512905 nonsense probably null
RF031:Blm UTSW 7 80512906 small insertion probably benign
RF031:Blm UTSW 7 80512923 small insertion probably benign
RF032:Blm UTSW 7 80512930 small insertion probably benign
RF036:Blm UTSW 7 80512914 nonsense probably null
RF044:Blm UTSW 7 80512930 small insertion probably benign
RF053:Blm UTSW 7 80512921 small insertion probably benign
RF064:Blm UTSW 7 80512923 nonsense probably null
X0061:Blm UTSW 7 80458850 missense possibly damaging 0.89
Predicted Primers PCR Primer
(F):5'- GGGAATTCAATAACGGCCTTTC -3'
(R):5'- GGCAAAGTGTCCAGGTTGTC -3'

Sequencing Primer
(F):5'- ACGGCCTTTCAAAGAGATTCTTCG -3'
(R):5'- GGATGATAGTCACATCGCTAAAC -3'
Posted On2015-04-30