Mutagenetix > Incidental Mutations

Incidental Mutation 'R4049:Arhgef10'

314040

Institutional Source

Beutler Lab

Gene Symbol

Arhgef10

Ensembl Gene

ENSMUSG00000071176

Gene Name

Rho guanine nucleotide exchange factor (GEF) 10

Synonyms

6430549H08Rik

MMRRC Submission

041616-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R4049 (G1)

Quality Score

204

Status

Validated

Chromosome

Chromosomal Location

14911663-15001085 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 14979998 bp

Zygosity

Heterozygous

Amino Acid Change

Threonine to Alanine at position 928 (T928A)

Ref Sequence

ENSEMBL: ENSMUSP00000106424 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000084207] [ENSMUST00000110800] [ENSMUST00000163062]

Predicted Effect

probably benign
Transcript: ENSMUST00000084207
AA Change: T967A

PolyPhen 2 Score 0.025 (Sensitivity: 0.95; Specificity: 0.81)

SMART Domains

Protein: ENSMUSP00000081225
Gene: ENSMUSG00000071176
AA Change: T967A

Domain	Start	End	E-Value	Type
low complexity region	73	82	N/A	INTRINSIC
low complexity region	155	165	N/A	INTRINSIC
low complexity region	236	245	N/A	INTRINSIC
low complexity region	247	265	N/A	INTRINSIC
coiled coil region	308	335	N/A	INTRINSIC
RhoGEF	401	583	9.79e-58	SMART
Blast:PH	617	829	6e-47	BLAST
low complexity region	1256	1272	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000110800
AA Change: T928A

PolyPhen 2 Score 0.048 (Sensitivity: 0.94; Specificity: 0.83)

SMART Domains

Protein: ENSMUSP00000106424
Gene: ENSMUSG00000071176
AA Change: T928A

Domain	Start	End	E-Value	Type
low complexity region	73	82	N/A	INTRINSIC
low complexity region	155	165	N/A	INTRINSIC
low complexity region	236	245	N/A	INTRINSIC
low complexity region	247	265	N/A	INTRINSIC
low complexity region	280	291	N/A	INTRINSIC
RhoGEF	362	544	9.79e-58	SMART
Blast:PH	578	790	8e-47	BLAST
low complexity region	1217	1233	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000163062
AA Change: T610A

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)

SMART Domains

Protein: ENSMUSP00000125526
Gene: ENSMUSG00000071176
AA Change: T610A

Domain	Start	End	E-Value	Type
RhoGEF	73	255	9.79e-58	SMART
Blast:PH	289	501	2e-47	BLAST
low complexity region	899	915	N/A	INTRINSIC

Meta Mutation Damage Score

0.0805

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.1%
20x: 94.6%

Validation Efficiency

100% (65/65)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a Rho guanine nucleotide exchange factor (GEF). Rho GEFs regulate the activity of small Rho GTPases by stimulating the exchange of guanine diphosphate (GDP) for guanine triphosphate (GTP) and may play a role in neural morphogenesis. Mutations in this gene are associated with slowed nerve conduction velocity (SNCV). Alternative splicing results in multiple transcript variants. [provided by RefSeq, Apr 2015]

Allele List at MGI

Other mutations in this stock

Total: 65 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcb5	T	A	12: 118,868,669	E1190V	probably damaging	Het
Arhgef10l	T	A	4: 140,515,451	I836F	probably benign	Het
Blm	T	A	7: 80,502,862	T446S	probably benign	Het
Ccdc63	T	A	5: 122,122,750	Q237L	probably damaging	Het
Cep57l1	G	T	10: 41,729,360	R130S	probably damaging	Het
Clstn2	T	G	9: 97,457,560	E786A	possibly damaging	Het
Col16a1	C	T	4: 130,068,752	P540L	probably damaging	Het
Csf2	A	G	11: 54,249,333	F61L	probably damaging	Het
Ctr9	C	T	7: 111,055,543	R1094C	unknown	Het
Cyp3a41a	A	G	5: 145,713,540	C98R	probably damaging	Het
Dthd1	T	A	5: 62,827,165	C404*	probably null	Het
Egfem1	A	C	3: 29,686,731	H518P	probably benign	Het
Elf3	T	C	1: 135,254,277	S369G	probably benign	Het
Eml6	C	T	11: 29,838,577	V503M	probably damaging	Het
Enthd1	T	C	15: 80,560,039	D105G	probably damaging	Het
Eral1	A	G	11: 78,075,602	L250P	probably damaging	Het
Gdf15	A	T	8: 70,629,955	M167K	probably benign	Het
Ggps1	T	C	13: 14,053,699	K300E	probably benign	Het
Gm8074	G	A	9: 78,322,336		noncoding transcript	Het
Herc3	A	G	6: 58,876,837	I623V	probably damaging	Het
Mad1l1	A	G	5: 140,132,816	S457P	probably damaging	Het
Map1lc3a	G	T	2: 155,277,542	V91F	possibly damaging	Het
Map4k3	A	G	17: 80,605,965	V617A	probably benign	Het
Mov10l1	T	A	15: 88,995,032		probably benign	Het
Mroh2a	A	G	1: 88,258,664	S64G	probably benign	Het
Ncor1	G	T	11: 62,329,668		probably null	Het
Nfe2	C	T	15: 103,250,937	E36K	possibly damaging	Het
Olfr1176	T	C	2: 88,343,800		probably null	Het
Olfr1212	A	G	2: 88,959,273	K269R	probably benign	Het
Olfr1251	T	C	2: 89,667,662	I75V	probably benign	Het
Olfr653	T	C	7: 104,580,368	F241L	probably benign	Het
Oprm1	G	A	10: 6,829,087	V95I	probably benign	Het
Pcdha9	T	A	18: 36,997,942	H21Q	probably benign	Het
Pcolce2	A	T	9: 95,638,755	I62F	probably damaging	Het
Pfpl	T	A	19: 12,429,689	C435S	probably damaging	Het
Pkhd1l1	G	A	15: 44,498,557	C542Y	probably damaging	Het
Plekha5	T	C	6: 140,583,871	S75P	probably damaging	Het
Pphln1	C	A	15: 93,465,106	A202E	probably damaging	Het
Ppp1r1a	A	G	15: 103,532,454	L92P	probably damaging	Het
Prokr2	T	C	2: 132,381,494	T43A	probably benign	Het
Rai14	T	C	15: 10,592,212	N199S	probably benign	Het
Rasgrp2	T	C	19: 6,404,727	L199P	probably damaging	Het
Rnf213	A	C	11: 119,482,448	M4939L	possibly damaging	Het
Slc23a2	C	T	2: 132,060,683	R533Q	probably benign	Het
Slc7a7	T	C	14: 54,373,091		probably null	Het
Snrpd2	T	A	7: 19,151,307	V31E	probably damaging	Het
Spire1	G	T	18: 67,529,031		probably null	Het
Srsf4	T	C	4: 131,900,543		probably benign	Het
Tcf20	A	G	15: 82,853,429	S1274P	probably damaging	Het
Tcof1	C	A	18: 60,832,903	A376S	possibly damaging	Het
Thsd1	T	A	8: 22,243,164	Y76N	possibly damaging	Het
Timm44	A	G	8: 4,260,561	V397A	probably benign	Het
Tmc6	G	A	11: 117,778,261	T89I	possibly damaging	Het
Trbv31	C	A	6: 41,557,705	C107F	probably damaging	Het
Trim37	T	A	11: 87,140,603		probably null	Het
Ttll5	T	C	12: 86,012,799	V1226A	probably benign	Het
Ube3b	T	C	5: 114,412,870	V865A	probably benign	Het
Vmn2r86	A	T	10: 130,447,097	M550K	probably damaging	Het
Vps54	C	A	11: 21,300,183	T373N	probably benign	Het
Wdr64	T	G	1: 175,805,856	I891S	probably benign	Het
Wisp2	A	G	2: 163,828,984	D137G	probably damaging	Het
Zfhx4	C	T	3: 5,398,859	S1384L	probably damaging	Het
Zfp703	A	G	8: 26,979,085	E259G	possibly damaging	Het
Zfp933	T	C	4: 147,826,512	H209R	probably damaging	Het
Zfp980	A	G	4: 145,702,600	H633R	probably damaging	Het

Other mutations in Arhgef10

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00766:Arhgef10	APN	8	14975006	missense	probably damaging	1.00
IGL00823:Arhgef10	APN	8	14940378	unclassified	probably benign
IGL01012:Arhgef10	APN	8	14979977	missense	probably damaging	0.99
IGL01311:Arhgef10	APN	8	14991054	splice site	probably null
IGL01596:Arhgef10	APN	8	14999468	nonsense	probably null
IGL01888:Arhgef10	APN	8	14962577	nonsense	probably null
IGL01938:Arhgef10	APN	8	14991062	missense	probably benign	0.09
IGL02151:Arhgef10	APN	8	14928889	missense	possibly damaging	0.77
IGL02274:Arhgef10	APN	8	14947205	missense	probably damaging	0.99
IGL02369:Arhgef10	APN	8	14997551	missense	probably damaging	1.00
IGL02411:Arhgef10	APN	8	14954819	missense	probably benign	0.01
IGL02500:Arhgef10	APN	8	14961238	missense	probably damaging	1.00
IGL02597:Arhgef10	APN	8	14930198	missense	probably benign	0.27
IGL02602:Arhgef10	APN	8	14930198	missense	probably benign	0.27
IGL02743:Arhgef10	APN	8	14930198	missense	probably benign	0.27
IGL02744:Arhgef10	APN	8	14930198	missense	probably benign	0.27
IGL03113:Arhgef10	APN	8	14954505	missense	probably damaging	1.00
IGL03248:Arhgef10	APN	8	14928847	missense	probably benign	0.00
P0028:Arhgef10	UTSW	8	14928925	missense	possibly damaging	0.79
P4748:Arhgef10	UTSW	8	14928925	missense	possibly damaging	0.79
R0049:Arhgef10	UTSW	8	14954446	missense	probably damaging	1.00
R0197:Arhgef10	UTSW	8	14962636	missense	probably damaging	1.00
R0479:Arhgef10	UTSW	8	14991070	missense	probably damaging	0.98
R0701:Arhgef10	UTSW	8	14962636	missense	probably damaging	1.00
R0966:Arhgef10	UTSW	8	14940343	missense	probably benign	0.01
R1367:Arhgef10	UTSW	8	14940225	missense	probably damaging	1.00
R1572:Arhgef10	UTSW	8	14991211	missense	possibly damaging	0.53
R1631:Arhgef10	UTSW	8	14947157	missense	probably damaging	0.98
R1766:Arhgef10	UTSW	8	14979836	missense	probably damaging	1.00
R1920:Arhgef10	UTSW	8	14956987	splice site	probably benign
R2051:Arhgef10	UTSW	8	14945320	missense	probably null	1.00
R2088:Arhgef10	UTSW	8	14983898	missense	possibly damaging	0.46
R2118:Arhgef10	UTSW	8	14934820	missense	probably damaging	0.99
R2120:Arhgef10	UTSW	8	14934820	missense	probably damaging	0.99
R2121:Arhgef10	UTSW	8	14934820	missense	probably damaging	0.99
R2122:Arhgef10	UTSW	8	14934820	missense	probably damaging	0.99
R2124:Arhgef10	UTSW	8	14934820	missense	probably damaging	0.99
R2318:Arhgef10	UTSW	8	14928855	missense	probably damaging	1.00
R2870:Arhgef10	UTSW	8	14975093	critical splice donor site	probably null
R2870:Arhgef10	UTSW	8	14975666	missense	probably benign	0.01
R2870:Arhgef10	UTSW	8	14975093	critical splice donor site	probably null
R2870:Arhgef10	UTSW	8	14975666	missense	probably benign	0.01
R2872:Arhgef10	UTSW	8	14975093	critical splice donor site	probably null
R2872:Arhgef10	UTSW	8	14975666	missense	probably benign	0.01
R2872:Arhgef10	UTSW	8	14975093	critical splice donor site	probably null
R2872:Arhgef10	UTSW	8	14975666	missense	probably benign	0.01
R2874:Arhgef10	UTSW	8	14975093	critical splice donor site	probably null
R2874:Arhgef10	UTSW	8	14975666	missense	probably benign	0.01
R3522:Arhgef10	UTSW	8	14954918	missense	probably damaging	1.00
R4324:Arhgef10	UTSW	8	14940335	missense	possibly damaging	0.77
R4351:Arhgef10	UTSW	8	14991145	nonsense	probably null
R4384:Arhgef10	UTSW	8	14930157	nonsense	probably null
R4385:Arhgef10	UTSW	8	14930157	nonsense	probably null
R4685:Arhgef10	UTSW	8	14956963	missense	probably damaging	1.00
R5111:Arhgef10	UTSW	8	14932408	missense	probably benign	0.00
R5169:Arhgef10	UTSW	8	14930051	missense	possibly damaging	0.80
R5670:Arhgef10	UTSW	8	14954774	missense	probably benign	0.01
R5945:Arhgef10	UTSW	8	14980028	critical splice donor site	probably null
R6593:Arhgef10	UTSW	8	14962522	missense	probably damaging	1.00
R6593:Arhgef10	UTSW	8	14962564	missense	possibly damaging	0.82
R6734:Arhgef10	UTSW	8	14975053	missense	probably damaging	1.00
R6859:Arhgef10	UTSW	8	14975005	missense	probably damaging	1.00
R6890:Arhgef10	UTSW	8	14928786	missense	probably benign	0.27
R7068:Arhgef10	UTSW	8	14958639	missense	probably damaging	1.00
R7081:Arhgef10	UTSW	8	14997547	nonsense	probably null
R7157:Arhgef10	UTSW	8	14930030	missense	probably damaging	1.00
R7232:Arhgef10	UTSW	8	14940323	missense	probably benign	0.10
R7514:Arhgef10	UTSW	8	14975956	missense	probably benign	0.16
R7544:Arhgef10	UTSW	8	14979854	missense	probably benign	0.34
R7657:Arhgef10	UTSW	8	14979893	missense	probably damaging	1.00
R7736:Arhgef10	UTSW	8	14980583	nonsense	probably null
R7777:Arhgef10	UTSW	8	14945373	missense	probably damaging	1.00
R8000:Arhgef10	UTSW	8	14930054	missense	probably damaging	1.00
R8060:Arhgef10	UTSW	8	14954446	missense	probably damaging	1.00
X0024:Arhgef10	UTSW	8	14978486	missense	probably benign	0.01
X0027:Arhgef10	UTSW	8	14997631	missense	possibly damaging	0.92
Z1088:Arhgef10	UTSW	8	14964191	missense	probably benign	0.01

Predicted Primers

PCR Primer
(F):5'- CGCCTCCTCTCTTAGATTGGAAG -3'
(R):5'- AGATTGGTTACCATGGGCATG -3'

Sequencing Primer
(F):5'- CTCTTAGATTGGAAGCTGTAGCAACC -3'
(R):5'- TACACTAGGCTCACACTC -3'

Posted On

2015-04-30