Incidental Mutation 'R4049:Thsd1'
ID314041
Institutional Source Beutler Lab
Gene Symbol Thsd1
Ensembl Gene ENSMUSG00000031480
Gene Namethrombospondin, type I, domain 1
SynonymsTmtsp, 4833423O18Rik
MMRRC Submission 041616-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4049 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location22227313-22261334 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 22243164 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Asparagine at position 76 (Y76N)
Ref Sequence ENSEMBL: ENSMUSP00000125118 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000069828] [ENSMUST00000160585] [ENSMUST00000162447]
Predicted Effect possibly damaging
Transcript: ENSMUST00000069828
AA Change: Y76N

PolyPhen 2 Score 0.485 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000067701
Gene: ENSMUSG00000031480
AA Change: Y76N

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
TSP1 342 392 4.55e-8 SMART
low complexity region 396 408 N/A INTRINSIC
transmembrane domain 413 435 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000160585
AA Change: Y76N

PolyPhen 2 Score 0.748 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000125118
Gene: ENSMUSG00000031480
AA Change: Y76N

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
low complexity region 343 355 N/A INTRINSIC
transmembrane domain 360 382 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000162447
AA Change: Y15N

PolyPhen 2 Score 0.485 (Sensitivity: 0.88; Specificity: 0.90)
Meta Mutation Damage Score 0.2819 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.6%
Validation Efficiency 100% (65/65)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene contains a type 1 thrombospondin domain, which is found in a number of proteins involved in the complement pathway, as well as in extracellular matrix proteins. Alternatively spliced transcript variants encoding different isoforms have been observed for this gene. [provided by RefSeq, Jan 2009]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb5 T A 12: 118,868,669 E1190V probably damaging Het
Arhgef10 A G 8: 14,979,998 T928A probably benign Het
Arhgef10l T A 4: 140,515,451 I836F probably benign Het
Blm T A 7: 80,502,862 T446S probably benign Het
Ccdc63 T A 5: 122,122,750 Q237L probably damaging Het
Cep57l1 G T 10: 41,729,360 R130S probably damaging Het
Clstn2 T G 9: 97,457,560 E786A possibly damaging Het
Col16a1 C T 4: 130,068,752 P540L probably damaging Het
Csf2 A G 11: 54,249,333 F61L probably damaging Het
Ctr9 C T 7: 111,055,543 R1094C unknown Het
Cyp3a41a A G 5: 145,713,540 C98R probably damaging Het
Dthd1 T A 5: 62,827,165 C404* probably null Het
Egfem1 A C 3: 29,686,731 H518P probably benign Het
Elf3 T C 1: 135,254,277 S369G probably benign Het
Eml6 C T 11: 29,838,577 V503M probably damaging Het
Enthd1 T C 15: 80,560,039 D105G probably damaging Het
Eral1 A G 11: 78,075,602 L250P probably damaging Het
Gdf15 A T 8: 70,629,955 M167K probably benign Het
Ggps1 T C 13: 14,053,699 K300E probably benign Het
Gm8074 G A 9: 78,322,336 noncoding transcript Het
Herc3 A G 6: 58,876,837 I623V probably damaging Het
Mad1l1 A G 5: 140,132,816 S457P probably damaging Het
Map1lc3a G T 2: 155,277,542 V91F possibly damaging Het
Map4k3 A G 17: 80,605,965 V617A probably benign Het
Mov10l1 T A 15: 88,995,032 probably benign Het
Mroh2a A G 1: 88,258,664 S64G probably benign Het
Ncor1 G T 11: 62,329,668 probably null Het
Nfe2 C T 15: 103,250,937 E36K possibly damaging Het
Olfr1176 T C 2: 88,343,800 probably null Het
Olfr1212 A G 2: 88,959,273 K269R probably benign Het
Olfr1251 T C 2: 89,667,662 I75V probably benign Het
Olfr653 T C 7: 104,580,368 F241L probably benign Het
Oprm1 G A 10: 6,829,087 V95I probably benign Het
Pcdha9 T A 18: 36,997,942 H21Q probably benign Het
Pcolce2 A T 9: 95,638,755 I62F probably damaging Het
Pfpl T A 19: 12,429,689 C435S probably damaging Het
Pkhd1l1 G A 15: 44,498,557 C542Y probably damaging Het
Plekha5 T C 6: 140,583,871 S75P probably damaging Het
Pphln1 C A 15: 93,465,106 A202E probably damaging Het
Ppp1r1a A G 15: 103,532,454 L92P probably damaging Het
Prokr2 T C 2: 132,381,494 T43A probably benign Het
Rai14 T C 15: 10,592,212 N199S probably benign Het
Rasgrp2 T C 19: 6,404,727 L199P probably damaging Het
Rnf213 A C 11: 119,482,448 M4939L possibly damaging Het
Slc23a2 C T 2: 132,060,683 R533Q probably benign Het
Slc7a7 T C 14: 54,373,091 probably null Het
Snrpd2 T A 7: 19,151,307 V31E probably damaging Het
Spire1 G T 18: 67,529,031 probably null Het
Srsf4 T C 4: 131,900,543 probably benign Het
Tcf20 A G 15: 82,853,429 S1274P probably damaging Het
Tcof1 C A 18: 60,832,903 A376S possibly damaging Het
Timm44 A G 8: 4,260,561 V397A probably benign Het
Tmc6 G A 11: 117,778,261 T89I possibly damaging Het
Trbv31 C A 6: 41,557,705 C107F probably damaging Het
Trim37 T A 11: 87,140,603 probably null Het
Ttll5 T C 12: 86,012,799 V1226A probably benign Het
Ube3b T C 5: 114,412,870 V865A probably benign Het
Vmn2r86 A T 10: 130,447,097 M550K probably damaging Het
Vps54 C A 11: 21,300,183 T373N probably benign Het
Wdr64 T G 1: 175,805,856 I891S probably benign Het
Wisp2 A G 2: 163,828,984 D137G probably damaging Het
Zfhx4 C T 3: 5,398,859 S1384L probably damaging Het
Zfp703 A G 8: 26,979,085 E259G possibly damaging Het
Zfp933 T C 4: 147,826,512 H209R probably damaging Het
Zfp980 A G 4: 145,702,600 H633R probably damaging Het
Other mutations in Thsd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01936:Thsd1 APN 8 22252231 missense probably damaging 1.00
IGL02288:Thsd1 APN 8 22259549 missense probably damaging 1.00
IGL02517:Thsd1 APN 8 22243438 missense probably damaging 1.00
IGL02591:Thsd1 APN 8 22258727 missense probably damaging 1.00
IGL03378:Thsd1 APN 8 22243778 missense probably benign 0.13
R0137:Thsd1 UTSW 8 22243039 missense probably damaging 1.00
R0507:Thsd1 UTSW 8 22258679 missense probably damaging 1.00
R0854:Thsd1 UTSW 8 22258571 missense probably damaging 0.99
R1109:Thsd1 UTSW 8 22243692 missense possibly damaging 0.93
R1402:Thsd1 UTSW 8 22259368 missense possibly damaging 0.68
R1402:Thsd1 UTSW 8 22259368 missense possibly damaging 0.68
R1899:Thsd1 UTSW 8 22252318 splice site probably benign
R1900:Thsd1 UTSW 8 22252318 splice site probably benign
R2008:Thsd1 UTSW 8 22259231 missense probably benign 0.23
R2048:Thsd1 UTSW 8 22259317 missense probably benign 0.01
R2090:Thsd1 UTSW 8 22259657 missense possibly damaging 0.95
R2165:Thsd1 UTSW 8 22238522 intron probably benign
R2209:Thsd1 UTSW 8 22258871 missense probably damaging 1.00
R3831:Thsd1 UTSW 8 22243116 missense possibly damaging 0.92
R3833:Thsd1 UTSW 8 22243116 missense possibly damaging 0.92
R3847:Thsd1 UTSW 8 22259411 missense probably damaging 0.97
R4454:Thsd1 UTSW 8 22243578 missense probably damaging 1.00
R4659:Thsd1 UTSW 8 22259298 nonsense probably null
R4997:Thsd1 UTSW 8 22243324 missense probably damaging 0.98
R6440:Thsd1 UTSW 8 22258553 missense possibly damaging 0.59
R6457:Thsd1 UTSW 8 22243347 missense probably damaging 0.97
R6488:Thsd1 UTSW 8 22243717 missense probably benign 0.36
R6519:Thsd1 UTSW 8 22259065 missense probably damaging 1.00
R7267:Thsd1 UTSW 8 22243581 missense probably benign 0.10
R7448:Thsd1 UTSW 8 22243333 missense possibly damaging 0.89
R7698:Thsd1 UTSW 8 22258987 nonsense probably null
R7733:Thsd1 UTSW 8 22258721 missense probably damaging 1.00
R7792:Thsd1 UTSW 8 22243098 missense probably damaging 0.99
R7894:Thsd1 UTSW 8 22259569 missense probably damaging 0.99
R7977:Thsd1 UTSW 8 22259569 missense probably damaging 0.99
X0023:Thsd1 UTSW 8 22259567 missense probably damaging 1.00
Z1088:Thsd1 UTSW 8 22252219 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATTTCCTTTCAGTCCTCGGAGAAG -3'
(R):5'- ACACCCACTTGAAAGGTGCC -3'

Sequencing Primer
(F):5'- GGAGAAGCCGAATACCTCCTC -3'
(R):5'- ACTTGAAAGGTGCCTTCTGC -3'
Posted On2015-04-30