Incidental Mutation 'R4049:Gdf15'
ID314043
Institutional Source Beutler Lab
Gene Symbol Gdf15
Ensembl Gene ENSMUSG00000038508
Gene Namegrowth differentiation factor 15
Synonymsmacrophage inhibiting cytokine-1, NAG-1, MIC-1
MMRRC Submission 041616-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4049 (G1)
Quality Score213
Status Validated
Chromosome8
Chromosomal Location70629393-70632456 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 70629955 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 167 (M167K)
Ref Sequence ENSEMBL: ENSMUSP00000105730 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003808] [ENSMUST00000110103]
Predicted Effect probably benign
Transcript: ENSMUST00000003808
AA Change: M167K

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000003808
Gene: ENSMUSG00000038508
AA Change: M167K

DomainStartEndE-ValueType
signal peptide 1 37 N/A INTRINSIC
low complexity region 143 166 N/A INTRINSIC
low complexity region 177 195 N/A INTRINSIC
TGFB 206 303 2.81e-22 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000110103
AA Change: M167K

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000105730
Gene: ENSMUSG00000038508
AA Change: M167K

DomainStartEndE-ValueType
signal peptide 1 37 N/A INTRINSIC
low complexity region 143 166 N/A INTRINSIC
low complexity region 177 195 N/A INTRINSIC
TGFB 206 303 2.81e-22 SMART
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.6%
Validation Efficiency 100% (65/65)
MGI Phenotype FUNCTION: This gene encodes a secreted ligand of the TGF-beta (transforming growth factor-beta) superfamily of proteins. Ligands of this family bind various TGF-beta receptors leading to recruitment and activation of SMAD family transcription factors that regulate gene expression. The encoded preproprotein is proteolytically processed to generate each subunit of the disulfide-linked homodimer. The protein is expressed in a broad range of cell types, acts as a pleiotropic cytokine and is involved in the stress response program of cells after cellular injury. Increased protein levels are associated with disease states such as tissue hypoxia, inflammation, acute injury and oxidative stress. Mice lacking a functional copy of this gene exhibit progressive loss of motor neurons, and more rapid blood clot formation. [provided by RefSeq, Aug 2016]
PHENOTYPE: Homozygous null mice showed no obvious major abnormalities, but exhibit progressive postnatal losses of spinal, facial, and trigeminal motoneurons, accelerated thrombus formation following injury, and decreased bleeding times. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb5 T A 12: 118,868,669 E1190V probably damaging Het
Arhgef10 A G 8: 14,979,998 T928A probably benign Het
Arhgef10l T A 4: 140,515,451 I836F probably benign Het
Blm T A 7: 80,502,862 T446S probably benign Het
Ccdc63 T A 5: 122,122,750 Q237L probably damaging Het
Cep57l1 G T 10: 41,729,360 R130S probably damaging Het
Clstn2 T G 9: 97,457,560 E786A possibly damaging Het
Col16a1 C T 4: 130,068,752 P540L probably damaging Het
Csf2 A G 11: 54,249,333 F61L probably damaging Het
Ctr9 C T 7: 111,055,543 R1094C unknown Het
Cyp3a41a A G 5: 145,713,540 C98R probably damaging Het
Dthd1 T A 5: 62,827,165 C404* probably null Het
Egfem1 A C 3: 29,686,731 H518P probably benign Het
Elf3 T C 1: 135,254,277 S369G probably benign Het
Eml6 C T 11: 29,838,577 V503M probably damaging Het
Enthd1 T C 15: 80,560,039 D105G probably damaging Het
Eral1 A G 11: 78,075,602 L250P probably damaging Het
Ggps1 T C 13: 14,053,699 K300E probably benign Het
Gm8074 G A 9: 78,322,336 noncoding transcript Het
Herc3 A G 6: 58,876,837 I623V probably damaging Het
Mad1l1 A G 5: 140,132,816 S457P probably damaging Het
Map1lc3a G T 2: 155,277,542 V91F possibly damaging Het
Map4k3 A G 17: 80,605,965 V617A probably benign Het
Mov10l1 T A 15: 88,995,032 probably benign Het
Mroh2a A G 1: 88,258,664 S64G probably benign Het
Ncor1 G T 11: 62,329,668 probably null Het
Nfe2 C T 15: 103,250,937 E36K possibly damaging Het
Olfr1176 T C 2: 88,343,800 probably null Het
Olfr1212 A G 2: 88,959,273 K269R probably benign Het
Olfr1251 T C 2: 89,667,662 I75V probably benign Het
Olfr653 T C 7: 104,580,368 F241L probably benign Het
Oprm1 G A 10: 6,829,087 V95I probably benign Het
Pcdha9 T A 18: 36,997,942 H21Q probably benign Het
Pcolce2 A T 9: 95,638,755 I62F probably damaging Het
Pfpl T A 19: 12,429,689 C435S probably damaging Het
Pkhd1l1 G A 15: 44,498,557 C542Y probably damaging Het
Plekha5 T C 6: 140,583,871 S75P probably damaging Het
Pphln1 C A 15: 93,465,106 A202E probably damaging Het
Ppp1r1a A G 15: 103,532,454 L92P probably damaging Het
Prokr2 T C 2: 132,381,494 T43A probably benign Het
Rai14 T C 15: 10,592,212 N199S probably benign Het
Rasgrp2 T C 19: 6,404,727 L199P probably damaging Het
Rnf213 A C 11: 119,482,448 M4939L possibly damaging Het
Slc23a2 C T 2: 132,060,683 R533Q probably benign Het
Slc7a7 T C 14: 54,373,091 probably null Het
Snrpd2 T A 7: 19,151,307 V31E probably damaging Het
Spire1 G T 18: 67,529,031 probably null Het
Srsf4 T C 4: 131,900,543 probably benign Het
Tcf20 A G 15: 82,853,429 S1274P probably damaging Het
Tcof1 C A 18: 60,832,903 A376S possibly damaging Het
Thsd1 T A 8: 22,243,164 Y76N possibly damaging Het
Timm44 A G 8: 4,260,561 V397A probably benign Het
Tmc6 G A 11: 117,778,261 T89I possibly damaging Het
Trbv31 C A 6: 41,557,705 C107F probably damaging Het
Trim37 T A 11: 87,140,603 probably null Het
Ttll5 T C 12: 86,012,799 V1226A probably benign Het
Ube3b T C 5: 114,412,870 V865A probably benign Het
Vmn2r86 A T 10: 130,447,097 M550K probably damaging Het
Vps54 C A 11: 21,300,183 T373N probably benign Het
Wdr64 T G 1: 175,805,856 I891S probably benign Het
Wisp2 A G 2: 163,828,984 D137G probably damaging Het
Zfhx4 C T 3: 5,398,859 S1384L probably damaging Het
Zfp703 A G 8: 26,979,085 E259G possibly damaging Het
Zfp933 T C 4: 147,826,512 H209R probably damaging Het
Zfp980 A G 4: 145,702,600 H633R probably damaging Het
Other mutations in Gdf15
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0090:Gdf15 UTSW 8 70629684 missense probably damaging 1.00
R1183:Gdf15 UTSW 8 70631552 missense probably benign 0.18
R4820:Gdf15 UTSW 8 70629596 missense probably damaging 1.00
R5893:Gdf15 UTSW 8 70629823 missense possibly damaging 0.96
R6941:Gdf15 UTSW 8 70630144 missense possibly damaging 0.93
R7161:Gdf15 UTSW 8 70631342 missense possibly damaging 0.93
R7690:Gdf15 UTSW 8 70631347 missense possibly damaging 0.68
X0066:Gdf15 UTSW 8 70629625 missense possibly damaging 0.95
Z1176:Gdf15 UTSW 8 70629890 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- GTGCTTTGATCTGCGCATGC -3'
(R):5'- CATGAGTAACCGGTGTTCTGG -3'

Sequencing Primer
(F):5'- ACGCACATGCTCAGCTG -3'
(R):5'- AGCTGCTACTCCGCGTCAAC -3'
Posted On2015-04-30