Incidental Mutation 'R4049:Oprm1'
ID314047
Institutional Source Beutler Lab
Gene Symbol Oprm1
Ensembl Gene ENSMUSG00000000766
Gene Nameopioid receptor, mu 1
SynonymsOprm, MOP receptor, mor, muOR, MOR-1, MOP-R
MMRRC Submission 041616-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.077) question?
Stock #R4049 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location6758506-7038198 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 6829087 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 95 (V95I)
Ref Sequence ENSEMBL: ENSMUSP00000101240 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000000783] [ENSMUST00000052751] [ENSMUST00000056385] [ENSMUST00000063036] [ENSMUST00000078634] [ENSMUST00000092729] [ENSMUST00000092731] [ENSMUST00000092734] [ENSMUST00000105597] [ENSMUST00000105601] [ENSMUST00000105602] [ENSMUST00000105603] [ENSMUST00000105604] [ENSMUST00000105605] [ENSMUST00000105607] [ENSMUST00000105611] [ENSMUST00000105615] [ENSMUST00000123861] [ENSMUST00000129221] [ENSMUST00000129954] [ENSMUST00000135502] [ENSMUST00000143875] [ENSMUST00000144264] [ENSMUST00000147171] [ENSMUST00000150374] [ENSMUST00000152674] [ENSMUST00000154906] [ENSMUST00000154941]
Predicted Effect probably benign
Transcript: ENSMUST00000000783
AA Change: V163I

PolyPhen 2 Score 0.303 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000000783
Gene: ENSMUSG00000000766
AA Change: V163I

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srx 76 339 1.6e-7 PFAM
Pfam:7TM_GPCR_Srsx 79 351 1.3e-10 PFAM
Pfam:7tm_1 85 336 4e-67 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000052751
AA Change: V163I

PolyPhen 2 Score 0.303 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000060329
Gene: ENSMUSG00000000766
AA Change: V163I

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srx 76 325 1.1e-7 PFAM
Pfam:7TM_GPCR_Srsx 79 351 1e-10 PFAM
Pfam:7tm_1 85 336 3.2e-67 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000056385
AA Change: V163I

PolyPhen 2 Score 0.303 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000060590
Gene: ENSMUSG00000000766
AA Change: V163I

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srx 76 325 1.7e-7 PFAM
Pfam:7TM_GPCR_Srsx 79 351 1e-10 PFAM
Pfam:7tm_1 85 336 3.3e-67 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000063036
AA Change: V95I

PolyPhen 2 Score 0.044 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000053498
Gene: ENSMUSG00000000766
AA Change: V95I

DomainStartEndE-ValueType
Pfam:7tm_1 24 268 8.7e-64 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000078634
AA Change: V163I

PolyPhen 2 Score 0.108 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000077704
Gene: ENSMUSG00000000766
AA Change: V163I

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srx 76 339 2.1e-7 PFAM
Pfam:7TM_GPCR_Srsx 79 351 2.4e-10 PFAM
Pfam:7tm_1 85 336 9e-60 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000092729
AA Change: V163I

PolyPhen 2 Score 0.303 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000090405
Gene: ENSMUSG00000000766
AA Change: V163I

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srx 76 325 1.7e-7 PFAM
Pfam:7TM_GPCR_Srsx 79 351 9.6e-11 PFAM
Pfam:7tm_1 85 336 3.1e-67 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000092731
AA Change: V163I

PolyPhen 2 Score 0.303 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000090407
Gene: ENSMUSG00000000766
AA Change: V163I

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srx 76 325 1e-7 PFAM
Pfam:7TM_GPCR_Srsx 79 351 9.9e-11 PFAM
Pfam:7tm_1 85 336 3.2e-67 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000092734
AA Change: V163I

PolyPhen 2 Score 0.303 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000090410
Gene: ENSMUSG00000000766
AA Change: V163I

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srx 76 325 1.7e-7 PFAM
Pfam:7TM_GPCR_Srsx 79 351 1e-10 PFAM
Pfam:7tm_1 85 336 3.3e-67 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000105597
Predicted Effect probably benign
Transcript: ENSMUST00000105601
SMART Domains Protein: ENSMUSP00000101226
Gene: ENSMUSG00000000766

DomainStartEndE-ValueType
SCOP:d1l9ha_ 46 100 3e-9 SMART
PDB:4DKL|A 52 100 3e-21 PDB
low complexity region 119 131 N/A INTRINSIC
low complexity region 173 184 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000105602
AA Change: V163I

PolyPhen 2 Score 0.303 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000101227
Gene: ENSMUSG00000000766
AA Change: V163I

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srx 76 325 1.8e-7 PFAM
Pfam:7TM_GPCR_Srsx 79 351 9.8e-11 PFAM
Pfam:7tm_1 85 336 3.1e-67 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000105603
AA Change: V163I

PolyPhen 2 Score 0.105 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000101228
Gene: ENSMUSG00000000766
AA Change: V163I

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srx 76 325 6.7e-8 PFAM
Pfam:7TM_GPCR_Srsx 79 351 9.6e-11 PFAM
Pfam:7tm_1 85 336 3.6e-67 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000105604
AA Change: V163I

PolyPhen 2 Score 0.089 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000101229
Gene: ENSMUSG00000000766
AA Change: V163I

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srx 76 332 5.1e-8 PFAM
Pfam:7TM_GPCR_Srsx 79 351 9.9e-11 PFAM
Pfam:7tm_1 85 336 3.8e-67 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000105605
AA Change: V163I

PolyPhen 2 Score 0.303 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000101230
Gene: ENSMUSG00000000766
AA Change: V163I

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srx 76 325 1e-7 PFAM
Pfam:7TM_GPCR_Srsx 79 351 9.8e-11 PFAM
Pfam:7tm_1 85 336 3.2e-67 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000105607
AA Change: V163I

PolyPhen 2 Score 0.303 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000101232
Gene: ENSMUSG00000000766
AA Change: V163I

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srx 76 325 1.7e-7 PFAM
Pfam:7TM_GPCR_Srsx 79 351 1e-10 PFAM
Pfam:7tm_1 85 336 3.3e-67 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000105611
AA Change: V163I

PolyPhen 2 Score 0.303 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000101236
Gene: ENSMUSG00000000766
AA Change: V163I

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srx 76 338 1.7e-7 PFAM
Pfam:7TM_GPCR_Srsx 79 351 1.4e-10 PFAM
Pfam:7tm_1 85 336 4.4e-67 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000105615
AA Change: V95I

PolyPhen 2 Score 0.358 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000101240
Gene: ENSMUSG00000000766
AA Change: V95I

DomainStartEndE-ValueType
Pfam:7tm_1 24 268 1.3e-63 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000123861
SMART Domains Protein: ENSMUSP00000120187
Gene: ENSMUSG00000000766

DomainStartEndE-ValueType
SCOP:d1l9ha_ 46 100 3e-9 SMART
PDB:4DKL|A 52 100 3e-21 PDB
low complexity region 119 131 N/A INTRINSIC
low complexity region 173 184 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000129221
AA Change: V99I

PolyPhen 2 Score 0.054 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000123117
Gene: ENSMUSG00000000766
AA Change: V99I

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srx 12 261 1.1e-7 PFAM
Pfam:7TM_GPCR_Srsx 15 287 7.3e-11 PFAM
Pfam:7tm_1 21 272 2.4e-67 PFAM
low complexity region 340 351 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000129954
AA Change: V163I

PolyPhen 2 Score 0.054 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000122385
Gene: ENSMUSG00000000766
AA Change: V163I

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srx 76 338 6.9e-8 PFAM
Pfam:7TM_GPCR_Srsx 79 351 1.5e-10 PFAM
Pfam:7tm_1 85 336 5.4e-67 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133486
Predicted Effect probably benign
Transcript: ENSMUST00000135502
AA Change: V163I

PolyPhen 2 Score 0.303 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000135143
Gene: ENSMUSG00000000766
AA Change: V163I

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srx 76 339 2.2e-7 PFAM
Pfam:7TM_GPCR_Srsx 79 351 1.9e-10 PFAM
Pfam:7tm_1 85 336 7.5e-67 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141897
Predicted Effect probably benign
Transcript: ENSMUST00000143875
Predicted Effect probably benign
Transcript: ENSMUST00000144264
AA Change: V163I

PolyPhen 2 Score 0.303 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000115836
Gene: ENSMUSG00000000766
AA Change: V163I

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srx 76 325 1.7e-7 PFAM
Pfam:7TM_GPCR_Srsx 79 351 1e-10 PFAM
Pfam:7tm_1 85 336 3.4e-67 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000147171
AA Change: V95I

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000117950
Gene: ENSMUSG00000000766
AA Change: V95I

DomainStartEndE-ValueType
Pfam:7tm_1 24 268 9.2e-64 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148625
Predicted Effect probably benign
Transcript: ENSMUST00000150374
Predicted Effect probably benign
Transcript: ENSMUST00000152674
SMART Domains Protein: ENSMUSP00000115552
Gene: ENSMUSG00000000766

DomainStartEndE-ValueType
SCOP:d1l9ha_ 46 94 8e-8 SMART
PDB:4DKL|A 52 94 7e-23 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000154906
AA Change: V163I

PolyPhen 2 Score 0.016 (Sensitivity: 0.95; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000114342
Gene: ENSMUSG00000000766
AA Change: V163I

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srx 76 332 1.5e-7 PFAM
Pfam:7TM_GPCR_Srsx 79 351 1.1e-10 PFAM
Pfam:7tm_1 85 336 3.6e-67 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000154941
AA Change: V99I

PolyPhen 2 Score 0.027 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000115413
Gene: ENSMUSG00000000766
AA Change: V99I

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srx 12 261 9.6e-8 PFAM
Pfam:7TM_GPCR_Srsx 15 287 6.1e-11 PFAM
Pfam:7tm_1 21 272 2e-67 PFAM
Meta Mutation Damage Score 0.0985 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.6%
Validation Efficiency 100% (65/65)
MGI Phenotype FUNCTION: This gene encodes the mu opioid receptor which is where drugs such as morphine and other opioids have pharmacological effects. Several alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Nov 2014]
PHENOTYPE: Homozygotes for null mutations exhibit isoform dependent loss of behavioral and gastrointestinal opioid responses and may also show impaired spatial memory, heightened nociception, reduced locomotor activity, increased hematopoietic proliferation, and decreased male fertility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb5 T A 12: 118,868,669 E1190V probably damaging Het
Arhgef10 A G 8: 14,979,998 T928A probably benign Het
Arhgef10l T A 4: 140,515,451 I836F probably benign Het
Blm T A 7: 80,502,862 T446S probably benign Het
Ccdc63 T A 5: 122,122,750 Q237L probably damaging Het
Cep57l1 G T 10: 41,729,360 R130S probably damaging Het
Clstn2 T G 9: 97,457,560 E786A possibly damaging Het
Col16a1 C T 4: 130,068,752 P540L probably damaging Het
Csf2 A G 11: 54,249,333 F61L probably damaging Het
Ctr9 C T 7: 111,055,543 R1094C unknown Het
Cyp3a41a A G 5: 145,713,540 C98R probably damaging Het
Dthd1 T A 5: 62,827,165 C404* probably null Het
Egfem1 A C 3: 29,686,731 H518P probably benign Het
Elf3 T C 1: 135,254,277 S369G probably benign Het
Eml6 C T 11: 29,838,577 V503M probably damaging Het
Enthd1 T C 15: 80,560,039 D105G probably damaging Het
Eral1 A G 11: 78,075,602 L250P probably damaging Het
Gdf15 A T 8: 70,629,955 M167K probably benign Het
Ggps1 T C 13: 14,053,699 K300E probably benign Het
Gm8074 G A 9: 78,322,336 noncoding transcript Het
Herc3 A G 6: 58,876,837 I623V probably damaging Het
Mad1l1 A G 5: 140,132,816 S457P probably damaging Het
Map1lc3a G T 2: 155,277,542 V91F possibly damaging Het
Map4k3 A G 17: 80,605,965 V617A probably benign Het
Mov10l1 T A 15: 88,995,032 probably benign Het
Mroh2a A G 1: 88,258,664 S64G probably benign Het
Ncor1 G T 11: 62,329,668 probably null Het
Nfe2 C T 15: 103,250,937 E36K possibly damaging Het
Olfr1176 T C 2: 88,343,800 probably null Het
Olfr1212 A G 2: 88,959,273 K269R probably benign Het
Olfr1251 T C 2: 89,667,662 I75V probably benign Het
Olfr653 T C 7: 104,580,368 F241L probably benign Het
Pcdha9 T A 18: 36,997,942 H21Q probably benign Het
Pcolce2 A T 9: 95,638,755 I62F probably damaging Het
Pfpl T A 19: 12,429,689 C435S probably damaging Het
Pkhd1l1 G A 15: 44,498,557 C542Y probably damaging Het
Plekha5 T C 6: 140,583,871 S75P probably damaging Het
Pphln1 C A 15: 93,465,106 A202E probably damaging Het
Ppp1r1a A G 15: 103,532,454 L92P probably damaging Het
Prokr2 T C 2: 132,381,494 T43A probably benign Het
Rai14 T C 15: 10,592,212 N199S probably benign Het
Rasgrp2 T C 19: 6,404,727 L199P probably damaging Het
Rnf213 A C 11: 119,482,448 M4939L possibly damaging Het
Slc23a2 C T 2: 132,060,683 R533Q probably benign Het
Slc7a7 T C 14: 54,373,091 probably null Het
Snrpd2 T A 7: 19,151,307 V31E probably damaging Het
Spire1 G T 18: 67,529,031 probably null Het
Srsf4 T C 4: 131,900,543 probably benign Het
Tcf20 A G 15: 82,853,429 S1274P probably damaging Het
Tcof1 C A 18: 60,832,903 A376S possibly damaging Het
Thsd1 T A 8: 22,243,164 Y76N possibly damaging Het
Timm44 A G 8: 4,260,561 V397A probably benign Het
Tmc6 G A 11: 117,778,261 T89I possibly damaging Het
Trbv31 C A 6: 41,557,705 C107F probably damaging Het
Trim37 T A 11: 87,140,603 probably null Het
Ttll5 T C 12: 86,012,799 V1226A probably benign Het
Ube3b T C 5: 114,412,870 V865A probably benign Het
Vmn2r86 A T 10: 130,447,097 M550K probably damaging Het
Vps54 C A 11: 21,300,183 T373N probably benign Het
Wdr64 T G 1: 175,805,856 I891S probably benign Het
Wisp2 A G 2: 163,828,984 D137G probably damaging Het
Zfhx4 C T 3: 5,398,859 S1384L probably damaging Het
Zfp703 A G 8: 26,979,085 E259G possibly damaging Het
Zfp933 T C 4: 147,826,512 H209R probably damaging Het
Zfp980 A G 4: 145,702,600 H633R probably damaging Het
Other mutations in Oprm1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01018:Oprm1 APN 10 7037170 utr 3 prime probably benign
IGL01768:Oprm1 APN 10 6829186 missense probably damaging 1.00
IGL02455:Oprm1 APN 10 6830219 missense probably damaging 1.00
IGL03391:Oprm1 APN 10 7014077 intron probably benign
IGL03410:Oprm1 APN 10 6830051 missense probably damaging 1.00
IGL03048:Oprm1 UTSW 10 6829064 missense probably damaging 1.00
R0189:Oprm1 UTSW 10 6789071 missense possibly damaging 0.94
R0321:Oprm1 UTSW 10 6829183 missense probably damaging 1.00
R0629:Oprm1 UTSW 10 6832604 unclassified probably null
R0730:Oprm1 UTSW 10 6832652 intron probably benign
R1542:Oprm1 UTSW 10 6788960 missense probably damaging 1.00
R1743:Oprm1 UTSW 10 6830105 missense probably damaging 0.99
R1874:Oprm1 UTSW 10 6789035 missense probably benign 0.17
R2864:Oprm1 UTSW 10 6794226 splice site probably null
R2964:Oprm1 UTSW 10 6788914 missense probably damaging 0.98
R3792:Oprm1 UTSW 10 6839544 missense probably benign 0.00
R4008:Oprm1 UTSW 10 6832520 missense probably benign
R4088:Oprm1 UTSW 10 6830234 missense probably damaging 1.00
R4724:Oprm1 UTSW 10 6758656 nonsense probably null
R4812:Oprm1 UTSW 10 6832698 intron probably benign
R4822:Oprm1 UTSW 10 6829036 missense probably damaging 0.99
R4855:Oprm1 UTSW 10 6838468 missense probably benign 0.01
R5072:Oprm1 UTSW 10 6832550 missense probably benign 0.15
R5768:Oprm1 UTSW 10 6789026 missense probably damaging 1.00
R5770:Oprm1 UTSW 10 6789026 missense probably damaging 1.00
R5995:Oprm1 UTSW 10 6832520 missense probably benign
R6327:Oprm1 UTSW 10 6830063 missense probably damaging 0.99
R7135:Oprm1 UTSW 10 6830203 missense possibly damaging 0.77
R7413:Oprm1 UTSW 10 6828919 missense probably damaging 1.00
R7455:Oprm1 UTSW 10 6830204 missense probably damaging 1.00
X0066:Oprm1 UTSW 10 6830462 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- AAGTAATTTCTTTGCTGTCCTTCGG -3'
(R):5'- AGGCCCCTGTTAACCCTTAC -3'

Sequencing Primer
(F):5'- GACTGCCACCAACATCTACATTTTC -3'
(R):5'- ACCCTGCCTGTATTTTGTGG -3'
Posted On2015-04-30