Incidental Mutation 'R4049:Cep57l1'
ID314048
Institutional Source Beutler Lab
Gene Symbol Cep57l1
Ensembl Gene ENSMUSG00000019813
Gene Namecentrosomal protein 57-like 1
Synonyms4930484D11Rik, 2410017P07Rik
MMRRC Submission 041616-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4049 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location41718840-41809871 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 41729360 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Serine at position 130 (R130S)
Ref Sequence ENSEMBL: ENSMUSP00000141031 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000019951] [ENSMUST00000105505] [ENSMUST00000186239] [ENSMUST00000187143] [ENSMUST00000189770] [ENSMUST00000190022] [ENSMUST00000191498]
Predicted Effect probably damaging
Transcript: ENSMUST00000019951
AA Change: R206S

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000019951
Gene: ENSMUSG00000019813
AA Change: R206S

DomainStartEndE-ValueType
Pfam:Cep57_CLD 50 227 1.2e-64 PFAM
low complexity region 234 245 N/A INTRINSIC
Pfam:Cep57_MT_bd 283 356 2.5e-20 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000105505
AA Change: R206S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000101144
Gene: ENSMUSG00000019813
AA Change: R206S

DomainStartEndE-ValueType
Pfam:Cep57_CLD 50 223 1.1e-66 PFAM
Pfam:Cep57_MT_bd 252 327 6.8e-22 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000186239
AA Change: R206S

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000139509
Gene: ENSMUSG00000019813
AA Change: R206S

DomainStartEndE-ValueType
Pfam:Cep57_CLD 50 227 2.3e-72 PFAM
low complexity region 234 245 N/A INTRINSIC
Pfam:Cep57_MT_bd 281 356 1e-21 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000187143
AA Change: R206S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000140389
Gene: ENSMUSG00000019813
AA Change: R206S

DomainStartEndE-ValueType
Pfam:Cep57_CLD 50 223 1.1e-66 PFAM
Pfam:Cep57_MT_bd 252 327 6.8e-22 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000187935
Predicted Effect noncoding transcript
Transcript: ENSMUST00000188463
Predicted Effect probably damaging
Transcript: ENSMUST00000189770
AA Change: R206S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000140147
Gene: ENSMUSG00000019813
AA Change: R206S

DomainStartEndE-ValueType
Pfam:Cep57_CLD 50 223 1.1e-66 PFAM
Pfam:Cep57_MT_bd 252 327 6.8e-22 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000190022
AA Change: R130S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000141031
Gene: ENSMUSG00000019813
AA Change: R130S

DomainStartEndE-ValueType
Pfam:Cep57_CLD 45 151 6.6e-38 PFAM
low complexity region 158 169 N/A INTRINSIC
Pfam:Cep57_MT_bd 205 280 1e-18 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000191498
AA Change: R206S

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000141089
Gene: ENSMUSG00000019813
AA Change: R206S

DomainStartEndE-ValueType
Pfam:Cep57_CLD 50 229 1.9e-65 PFAM
Meta Mutation Damage Score 0.6311 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.6%
Validation Efficiency 100% (65/65)
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb5 T A 12: 118,868,669 E1190V probably damaging Het
Arhgef10 A G 8: 14,979,998 T928A probably benign Het
Arhgef10l T A 4: 140,515,451 I836F probably benign Het
Blm T A 7: 80,502,862 T446S probably benign Het
Ccdc63 T A 5: 122,122,750 Q237L probably damaging Het
Clstn2 T G 9: 97,457,560 E786A possibly damaging Het
Col16a1 C T 4: 130,068,752 P540L probably damaging Het
Csf2 A G 11: 54,249,333 F61L probably damaging Het
Ctr9 C T 7: 111,055,543 R1094C unknown Het
Cyp3a41a A G 5: 145,713,540 C98R probably damaging Het
Dthd1 T A 5: 62,827,165 C404* probably null Het
Egfem1 A C 3: 29,686,731 H518P probably benign Het
Elf3 T C 1: 135,254,277 S369G probably benign Het
Eml6 C T 11: 29,838,577 V503M probably damaging Het
Enthd1 T C 15: 80,560,039 D105G probably damaging Het
Eral1 A G 11: 78,075,602 L250P probably damaging Het
Gdf15 A T 8: 70,629,955 M167K probably benign Het
Ggps1 T C 13: 14,053,699 K300E probably benign Het
Gm8074 G A 9: 78,322,336 noncoding transcript Het
Herc3 A G 6: 58,876,837 I623V probably damaging Het
Mad1l1 A G 5: 140,132,816 S457P probably damaging Het
Map1lc3a G T 2: 155,277,542 V91F possibly damaging Het
Map4k3 A G 17: 80,605,965 V617A probably benign Het
Mov10l1 T A 15: 88,995,032 probably benign Het
Mroh2a A G 1: 88,258,664 S64G probably benign Het
Ncor1 G T 11: 62,329,668 probably null Het
Nfe2 C T 15: 103,250,937 E36K possibly damaging Het
Olfr1176 T C 2: 88,343,800 probably null Het
Olfr1212 A G 2: 88,959,273 K269R probably benign Het
Olfr1251 T C 2: 89,667,662 I75V probably benign Het
Olfr653 T C 7: 104,580,368 F241L probably benign Het
Oprm1 G A 10: 6,829,087 V95I probably benign Het
Pcdha9 T A 18: 36,997,942 H21Q probably benign Het
Pcolce2 A T 9: 95,638,755 I62F probably damaging Het
Pfpl T A 19: 12,429,689 C435S probably damaging Het
Pkhd1l1 G A 15: 44,498,557 C542Y probably damaging Het
Plekha5 T C 6: 140,583,871 S75P probably damaging Het
Pphln1 C A 15: 93,465,106 A202E probably damaging Het
Ppp1r1a A G 15: 103,532,454 L92P probably damaging Het
Prokr2 T C 2: 132,381,494 T43A probably benign Het
Rai14 T C 15: 10,592,212 N199S probably benign Het
Rasgrp2 T C 19: 6,404,727 L199P probably damaging Het
Rnf213 A C 11: 119,482,448 M4939L possibly damaging Het
Slc23a2 C T 2: 132,060,683 R533Q probably benign Het
Slc7a7 T C 14: 54,373,091 probably null Het
Snrpd2 T A 7: 19,151,307 V31E probably damaging Het
Spire1 G T 18: 67,529,031 probably null Het
Srsf4 T C 4: 131,900,543 probably benign Het
Tcf20 A G 15: 82,853,429 S1274P probably damaging Het
Tcof1 C A 18: 60,832,903 A376S possibly damaging Het
Thsd1 T A 8: 22,243,164 Y76N possibly damaging Het
Timm44 A G 8: 4,260,561 V397A probably benign Het
Tmc6 G A 11: 117,778,261 T89I possibly damaging Het
Trbv31 C A 6: 41,557,705 C107F probably damaging Het
Trim37 T A 11: 87,140,603 probably null Het
Ttll5 T C 12: 86,012,799 V1226A probably benign Het
Ube3b T C 5: 114,412,870 V865A probably benign Het
Vmn2r86 A T 10: 130,447,097 M550K probably damaging Het
Vps54 C A 11: 21,300,183 T373N probably benign Het
Wdr64 T G 1: 175,805,856 I891S probably benign Het
Wisp2 A G 2: 163,828,984 D137G probably damaging Het
Zfhx4 C T 3: 5,398,859 S1384L probably damaging Het
Zfp703 A G 8: 26,979,085 E259G possibly damaging Het
Zfp933 T C 4: 147,826,512 H209R probably damaging Het
Zfp980 A G 4: 145,702,600 H633R probably damaging Het
Other mutations in Cep57l1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00402:Cep57l1 APN 10 41721551 intron probably benign
IGL00679:Cep57l1 APN 10 41719800 nonsense probably null
IGL00839:Cep57l1 APN 10 41731093 missense probably damaging 1.00
IGL01013:Cep57l1 APN 10 41740869 nonsense probably null
IGL01479:Cep57l1 APN 10 41728639 missense possibly damaging 0.95
IGL01830:Cep57l1 APN 10 41728653 missense probably benign 0.03
IGL02005:Cep57l1 APN 10 41740961 missense probably benign 0.39
IGL02679:Cep57l1 APN 10 41729386 missense probably damaging 1.00
IGL02697:Cep57l1 APN 10 41722954 missense possibly damaging 0.83
IGL03328:Cep57l1 APN 10 41743152 missense probably damaging 1.00
R2147:Cep57l1 UTSW 10 41740899 missense probably damaging 0.97
R3712:Cep57l1 UTSW 10 41743114 missense probably damaging 1.00
R4050:Cep57l1 UTSW 10 41729360 missense probably damaging 1.00
R4661:Cep57l1 UTSW 10 41719771 missense possibly damaging 0.91
R4764:Cep57l1 UTSW 10 41721682 missense possibly damaging 0.81
R4929:Cep57l1 UTSW 10 41745914 missense possibly damaging 0.93
R6058:Cep57l1 UTSW 10 41740922 missense possibly damaging 0.87
R6386:Cep57l1 UTSW 10 41743132 missense probably damaging 1.00
R6788:Cep57l1 UTSW 10 41743149 missense probably damaging 1.00
R7334:Cep57l1 UTSW 10 41721600 missense probably benign 0.00
R7724:Cep57l1 UTSW 10 41745842 missense possibly damaging 0.65
R7738:Cep57l1 UTSW 10 41740846 missense probably damaging 1.00
R7792:Cep57l1 UTSW 10 41722940 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GTGCAAGGTCCTTTGGCAAG -3'
(R):5'- AGTTAGAAAGCCGAGAGATGTCTTG -3'

Sequencing Primer
(F):5'- CCTTTGGCAAGGTAGTCAAGTC -3'
(R):5'- AGATGTCTTGGAGTCTTTTGCCATTC -3'
Posted On2015-04-30