Incidental Mutation 'R0388:Lgi2'
ID 31405
Institutional Source Beutler Lab
Gene Symbol Lgi2
Ensembl Gene ENSMUSG00000039252
Gene Name leucine-rich repeat LGI family, member 2
Synonyms
MMRRC Submission 038594-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.066) question?
Stock # R0388 (G1)
Quality Score 225
Status Validated
Chromosome 5
Chromosomal Location 52533517-52566462 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 52554549 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Glycine at position 143 (E143G)
Ref Sequence ENSEMBL: ENSMUSP00000040436 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039750] [ENSMUST00000199942]
AlphaFold Q8K4Z0
Predicted Effect probably damaging
Transcript: ENSMUST00000039750
AA Change: E143G

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000040436
Gene: ENSMUSG00000039252
AA Change: E143G

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
Blast:LRRNT 32 62 9e-15 BLAST
LRR_TYP 81 104 7.26e-3 SMART
LRR_TYP 105 128 4.72e-2 SMART
LRRCT 140 189 4.49e-4 SMART
Pfam:EPTP 224 265 3.9e-12 PFAM
Pfam:EPTP 270 311 2e-13 PFAM
Pfam:EPTP 316 362 2.1e-16 PFAM
Pfam:EPTP 365 407 2.3e-9 PFAM
Pfam:EPTP 412 454 4.8e-12 PFAM
Pfam:EPTP 457 498 2.7e-14 PFAM
low complexity region 499 509 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000199942
AA Change: E167G

PolyPhen 2 Score 0.501 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000143707
Gene: ENSMUSG00000039252
AA Change: E167G

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
Blast:LRRNT 32 62 7e-15 BLAST
LRR_TYP 81 104 7.26e-3 SMART
LRR_TYP 105 128 4.72e-2 SMART
LRR_TYP 129 152 5.99e-4 SMART
LRRCT 164 213 4.49e-4 SMART
Pfam:EPTP 216 257 5.6e-12 PFAM
Pfam:EPTP 262 303 2.8e-13 PFAM
Pfam:EPTP 308 354 3e-16 PFAM
Pfam:EPTP 357 399 3.3e-9 PFAM
Pfam:EPTP 404 446 6.8e-12 PFAM
Pfam:EPTP 449 490 3.8e-14 PFAM
low complexity region 491 501 N/A INTRINSIC
Meta Mutation Damage Score 0.0824 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.0%
  • 10x: 95.6%
  • 20x: 90.7%
Validation Efficiency 100% (67/67)
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010315B03Rik T C 9: 124,295,159 probably benign Het
Acsbg1 T C 9: 54,609,063 K678R probably damaging Het
Adgrg6 A G 10: 14,450,658 I410T probably benign Het
Afap1l2 A C 19: 56,917,242 probably benign Het
Aox2 T C 1: 58,354,406 Y1242H probably damaging Het
Apoo-ps T C 13: 107,414,673 noncoding transcript Het
Camta1 C A 4: 151,075,140 R1614L probably damaging Het
Cdh3 C A 8: 106,539,129 T268K probably damaging Het
Chd5 T A 4: 152,371,644 H923Q probably damaging Het
Chd7 T C 4: 8,854,560 V1967A probably benign Het
Cntn3 T C 6: 102,277,316 M222V probably damaging Het
Dcaf17 A G 2: 71,078,571 K277R probably benign Het
Dmbt1 T C 7: 131,096,049 probably benign Het
Dmpk T A 7: 19,084,077 probably benign Het
Dzank1 A T 2: 144,476,106 L714Q possibly damaging Het
Efcab3 A G 11: 105,109,401 D272G possibly damaging Het
Erbb2 G C 11: 98,427,351 R471P possibly damaging Het
Esf1 T A 2: 140,120,871 Y760F possibly damaging Het
Fanci C A 7: 79,439,630 T938K probably benign Het
Gnai3 A G 3: 108,115,757 probably benign Het
Hspg2 T A 4: 137,511,158 C319S probably damaging Het
Il12a T A 3: 68,695,187 probably null Het
Inpp4a A G 1: 37,396,160 D837G probably damaging Het
Kcnj5 T A 9: 32,317,863 E13V probably damaging Het
Kcnq3 T A 15: 66,000,038 Y594F probably benign Het
Kif16b T C 2: 142,740,937 E556G probably damaging Het
Kif28 T C 1: 179,740,089 I39V possibly damaging Het
Mast1 T G 8: 84,915,537 I1063L probably benign Het
Med12l T C 3: 59,093,504 probably benign Het
Mmp19 G T 10: 128,798,883 R456L probably benign Het
Mon1b T A 8: 113,639,078 V346E probably damaging Het
Mpv17l A T 16: 13,940,999 I96L probably benign Het
Mrgpra9 A T 7: 47,252,794 M1K probably null Het
Mycbp2 A T 14: 103,156,667 H2819Q probably benign Het
Nav1 A C 1: 135,448,917 probably benign Het
Neurl4 T C 11: 69,911,733 probably benign Het
Ntng2 G C 2: 29,207,426 P341R probably damaging Het
Oas1d A T 5: 120,917,028 Y221F probably damaging Het
Olfr1040 A G 2: 86,146,630 Y35H probably damaging Het
Olfr348 C A 2: 36,786,862 D112E probably benign Het
Olfr365 A C 2: 37,202,184 probably null Het
Osbpl8 A G 10: 111,272,282 M380V probably benign Het
Pank1 T C 19: 34,821,706 probably benign Het
Parn T C 16: 13,654,476 D169G possibly damaging Het
Pknox1 T A 17: 31,603,192 I311N probably damaging Het
Pprc1 T C 19: 46,062,775 V248A possibly damaging Het
Prkcq T C 2: 11,254,234 C322R probably benign Het
Ptpn13 T A 5: 103,555,062 I1298N probably benign Het
Rab11fip3 A G 17: 26,069,072 S36P probably benign Het
Rif1 GCCACCA GCCA 2: 52,110,324 probably benign Het
Sass6 C A 3: 116,607,308 probably benign Het
Shroom3 G A 5: 92,951,293 G1463D probably benign Het
Slc35d1 A T 4: 103,184,887 Y249* probably null Het
Slc9a3 C T 13: 74,121,536 P8S unknown Het
Slc9a9 T A 9: 94,939,563 probably null Het
Syne2 T A 12: 75,986,975 M3666K probably benign Het
Synpo2 A G 3: 123,079,897 V1140A probably benign Het
Thada A G 17: 84,231,096 F1495L probably benign Het
Timeless A G 10: 128,241,425 probably null Het
Tlr6 G T 5: 64,955,205 H120N possibly damaging Het
Tmem173 A G 18: 35,735,111 probably null Het
Tns3 T C 11: 8,445,703 I1234V probably benign Het
Ttll9 A G 2: 153,000,179 S318G probably benign Het
Vps13c T C 9: 67,922,915 probably benign Het
Zfp933 T C 4: 147,826,442 I232M probably benign Het
Zfyve27 T C 19: 42,189,585 S382P probably damaging Het
Other mutations in Lgi2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00861:Lgi2 APN 5 52538121 missense probably benign
IGL01310:Lgi2 APN 5 52554465 missense probably benign 0.44
IGL02086:Lgi2 APN 5 52565957 missense probably damaging 0.96
IGL03091:Lgi2 APN 5 52563965 critical splice donor site probably null
IGL03367:Lgi2 APN 5 52562160 missense probably damaging 1.00
IGL03388:Lgi2 APN 5 52538477 missense probably damaging 1.00
R0602:Lgi2 UTSW 5 52554423 missense probably damaging 0.98
R0633:Lgi2 UTSW 5 52554460 missense probably damaging 0.97
R1616:Lgi2 UTSW 5 52546638 missense probably benign 0.00
R1916:Lgi2 UTSW 5 52546632 missense probably benign
R2072:Lgi2 UTSW 5 52538505 missense probably damaging 1.00
R2512:Lgi2 UTSW 5 52537965 makesense probably null
R4614:Lgi2 UTSW 5 52538433 missense probably damaging 0.99
R4855:Lgi2 UTSW 5 52538507 missense probably damaging 1.00
R5092:Lgi2 UTSW 5 52538087 missense probably damaging 1.00
R5181:Lgi2 UTSW 5 52554450 missense probably damaging 1.00
R5311:Lgi2 UTSW 5 52554485 missense probably damaging 0.99
R6074:Lgi2 UTSW 5 52546642 missense probably benign
R7089:Lgi2 UTSW 5 52538490 missense probably damaging 0.99
R7376:Lgi2 UTSW 5 52538262 missense probably damaging 0.99
R7396:Lgi2 UTSW 5 52538411 missense probably damaging 1.00
R7733:Lgi2 UTSW 5 52538531 missense probably benign 0.03
R8007:Lgi2 UTSW 5 52566033 missense probably benign 0.01
R8073:Lgi2 UTSW 5 52546671 missense probably benign
R9137:Lgi2 UTSW 5 52538019 missense probably damaging 1.00
R9484:Lgi2 UTSW 5 52538594 missense probably benign 0.36
R9505:Lgi2 UTSW 5 52554433 missense probably benign 0.00
R9723:Lgi2 UTSW 5 52538501 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTACCTGTGGTGGTACACTCATAGTCAA -3'
(R):5'- TGCTGAGACAATTTTAAGAGGGCTGATG -3'

Sequencing Primer
(F):5'- AGTCAAAGCTGGTCACTTCG -3'
(R):5'- ctttcacttccatactgctgttc -3'
Posted On 2013-04-24