Incidental Mutation 'R4049:Trim37'
ID314055
Institutional Source Beutler Lab
Gene Symbol Trim37
Ensembl Gene ENSMUSG00000018548
Gene Nametripartite motif-containing 37
SynonymsMUL, 1110032A10Rik, 2810004E07Rik, TEF3
MMRRC Submission 041616-MU
Accession Numbers

Genbank: NM_197987

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4049 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location87127077-87220683 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to A at 87140603 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000119269 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041282] [ENSMUST00000139532]
Predicted Effect probably null
Transcript: ENSMUST00000041282
SMART Domains Protein: ENSMUSP00000049057
Gene: ENSMUSG00000018548

DomainStartEndE-ValueType
RING 15 54 1.71e-1 SMART
BBOX 90 132 7.32e-12 SMART
BBC 132 254 3.05e-31 SMART
MATH 281 384 1.51e-13 SMART
low complexity region 494 504 N/A INTRINSIC
low complexity region 516 529 N/A INTRINSIC
low complexity region 535 545 N/A INTRINSIC
low complexity region 579 588 N/A INTRINSIC
low complexity region 612 626 N/A INTRINSIC
low complexity region 795 808 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000139532
SMART Domains Protein: ENSMUSP00000119269
Gene: ENSMUSG00000018548

DomainStartEndE-ValueType
BBOX 75 117 7.32e-12 SMART
Meta Mutation Damage Score 0.9753 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.6%
Validation Efficiency 100% (65/65)
MGI Phenotype FUNCTION: The protein encoded by this gene is part of the tripartite-motif containing family (TRIM), which is typified by the RING, B-box type 1, B-box type 2, and coiled-coil region domains. In mouse this protein is proposed to oligomerize through its coiled coil domain and has been reported to be expressed in neural crest-derived tissues as well as in tissues whose development is regulated by mesenchymal-epithelial interactions. In humans, mutations in this gene are associated with mulibrey (muscle-liver-brain-eye) nanism, an autosomal recessive disorder characterized by prenatal onset growth failure, cardiomyopathy and dysmorphic features. [provided by RefSeq, Jan 2013]
PHENOTYPE: Mice homozygous for a knock-out allele are infertile due to gonadal degeneration and exhibit late-onset weight loss, smaller skull size, non-compaction cardiomyopathy, hepatomegaly, fatty liver, altered glucose metabolism, splenomegaly, and increased tumor incidence. [provided by MGI curators]
Allele List at MGI

All alleles(7) : Gene trapped(7)

Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb5 T A 12: 118,868,669 E1190V probably damaging Het
Arhgef10 A G 8: 14,979,998 T928A probably benign Het
Arhgef10l T A 4: 140,515,451 I836F probably benign Het
Blm T A 7: 80,502,862 T446S probably benign Het
Ccdc63 T A 5: 122,122,750 Q237L probably damaging Het
Cep57l1 G T 10: 41,729,360 R130S probably damaging Het
Clstn2 T G 9: 97,457,560 E786A possibly damaging Het
Col16a1 C T 4: 130,068,752 P540L probably damaging Het
Csf2 A G 11: 54,249,333 F61L probably damaging Het
Ctr9 C T 7: 111,055,543 R1094C unknown Het
Cyp3a41a A G 5: 145,713,540 C98R probably damaging Het
Dthd1 T A 5: 62,827,165 C404* probably null Het
Egfem1 A C 3: 29,686,731 H518P probably benign Het
Elf3 T C 1: 135,254,277 S369G probably benign Het
Eml6 C T 11: 29,838,577 V503M probably damaging Het
Enthd1 T C 15: 80,560,039 D105G probably damaging Het
Eral1 A G 11: 78,075,602 L250P probably damaging Het
Gdf15 A T 8: 70,629,955 M167K probably benign Het
Ggps1 T C 13: 14,053,699 K300E probably benign Het
Gm8074 G A 9: 78,322,336 noncoding transcript Het
Herc3 A G 6: 58,876,837 I623V probably damaging Het
Mad1l1 A G 5: 140,132,816 S457P probably damaging Het
Map1lc3a G T 2: 155,277,542 V91F possibly damaging Het
Map4k3 A G 17: 80,605,965 V617A probably benign Het
Mov10l1 T A 15: 88,995,032 probably benign Het
Mroh2a A G 1: 88,258,664 S64G probably benign Het
Ncor1 G T 11: 62,329,668 probably null Het
Nfe2 C T 15: 103,250,937 E36K possibly damaging Het
Olfr1176 T C 2: 88,343,800 probably null Het
Olfr1212 A G 2: 88,959,273 K269R probably benign Het
Olfr1251 T C 2: 89,667,662 I75V probably benign Het
Olfr653 T C 7: 104,580,368 F241L probably benign Het
Oprm1 G A 10: 6,829,087 V95I probably benign Het
Pcdha9 T A 18: 36,997,942 H21Q probably benign Het
Pcolce2 A T 9: 95,638,755 I62F probably damaging Het
Pfpl T A 19: 12,429,689 C435S probably damaging Het
Pkhd1l1 G A 15: 44,498,557 C542Y probably damaging Het
Plekha5 T C 6: 140,583,871 S75P probably damaging Het
Pphln1 C A 15: 93,465,106 A202E probably damaging Het
Ppp1r1a A G 15: 103,532,454 L92P probably damaging Het
Prokr2 T C 2: 132,381,494 T43A probably benign Het
Rai14 T C 15: 10,592,212 N199S probably benign Het
Rasgrp2 T C 19: 6,404,727 L199P probably damaging Het
Rnf213 A C 11: 119,482,448 M4939L possibly damaging Het
Slc23a2 C T 2: 132,060,683 R533Q probably benign Het
Slc7a7 T C 14: 54,373,091 probably null Het
Snrpd2 T A 7: 19,151,307 V31E probably damaging Het
Spire1 G T 18: 67,529,031 probably null Het
Srsf4 T C 4: 131,900,543 probably benign Het
Tcf20 A G 15: 82,853,429 S1274P probably damaging Het
Tcof1 C A 18: 60,832,903 A376S possibly damaging Het
Thsd1 T A 8: 22,243,164 Y76N possibly damaging Het
Timm44 A G 8: 4,260,561 V397A probably benign Het
Tmc6 G A 11: 117,778,261 T89I possibly damaging Het
Trbv31 C A 6: 41,557,705 C107F probably damaging Het
Ttll5 T C 12: 86,012,799 V1226A probably benign Het
Ube3b T C 5: 114,412,870 V865A probably benign Het
Vmn2r86 A T 10: 130,447,097 M550K probably damaging Het
Vps54 C A 11: 21,300,183 T373N probably benign Het
Wdr64 T G 1: 175,805,856 I891S probably benign Het
Wisp2 A G 2: 163,828,984 D137G probably damaging Het
Zfhx4 C T 3: 5,398,859 S1384L probably damaging Het
Zfp703 A G 8: 26,979,085 E259G possibly damaging Het
Zfp933 T C 4: 147,826,512 H209R probably damaging Het
Zfp980 A G 4: 145,702,600 H633R probably damaging Het
Other mutations in Trim37
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00708:Trim37 APN 11 87186393 missense probably damaging 1.00
IGL01372:Trim37 APN 11 87184946 missense probably benign 0.00
IGL01510:Trim37 APN 11 87177860 missense probably damaging 1.00
IGL02055:Trim37 APN 11 87166649 missense probably benign 0.44
IGL02106:Trim37 APN 11 87201404 nonsense probably null
IGL02251:Trim37 APN 11 87167430 splice site probably benign
IGL02498:Trim37 APN 11 87185050 missense probably benign
IGL02836:Trim37 APN 11 87196959 missense probably benign 0.01
IGL03089:Trim37 APN 11 87190137 missense probably damaging 1.00
IGL03302:Trim37 APN 11 87147001 missense possibly damaging 0.89
IGL03347:Trim37 APN 11 87201621 missense possibly damaging 0.80
G5030:Trim37 UTSW 11 87143141 missense probably damaging 0.96
R0396:Trim37 UTSW 11 87146968 missense probably damaging 1.00
R0544:Trim37 UTSW 11 87145502 nonsense probably null
R0946:Trim37 UTSW 11 87146955 missense probably damaging 0.99
R1481:Trim37 UTSW 11 87129759 nonsense probably null
R1799:Trim37 UTSW 11 87178019 missense probably damaging 1.00
R1851:Trim37 UTSW 11 87218306 missense probably damaging 1.00
R2107:Trim37 UTSW 11 87159825 missense probably benign 0.04
R3878:Trim37 UTSW 11 87206002 missense probably benign 0.10
R4224:Trim37 UTSW 11 87216463 missense probably damaging 1.00
R4486:Trim37 UTSW 11 87196825 missense probably benign 0.31
R5244:Trim37 UTSW 11 87218257 missense probably benign 0.10
R5343:Trim37 UTSW 11 87137603 missense probably damaging 0.98
R5417:Trim37 UTSW 11 87166679 missense probably damaging 1.00
R5894:Trim37 UTSW 11 87201440 missense probably damaging 0.99
R5911:Trim37 UTSW 11 87196837 nonsense probably null
R5957:Trim37 UTSW 11 87145551 missense probably damaging 1.00
R6159:Trim37 UTSW 11 87216548 critical splice donor site probably null
R6479:Trim37 UTSW 11 87216487 nonsense probably null
R6527:Trim37 UTSW 11 87190084 missense probably damaging 1.00
R7021:Trim37 UTSW 11 87167509 missense probably benign 0.01
R7734:Trim37 UTSW 11 87177995 missense probably damaging 1.00
R7849:Trim37 UTSW 11 87201444 missense possibly damaging 0.87
R7932:Trim37 UTSW 11 87201444 missense possibly damaging 0.87
R8046:Trim37 UTSW 11 87146968 missense possibly damaging 0.89
Z1177:Trim37 UTSW 11 87185043 missense probably benign
Predicted Primers PCR Primer
(F):5'- GCCCATGGTATCATTTTGTACAGG -3'
(R):5'- GCATTTACTTTGCATGTGGCC -3'

Sequencing Primer
(F):5'- ACCTTACTGTGTAGACCAGGCTAG -3'
(R):5'- GCATGTGGCCCCAGGATAAATC -3'
Posted On2015-04-30