Incidental Mutation 'R4049:Tmc6'
ID314056
Institutional Source Beutler Lab
Gene Symbol Tmc6
Ensembl Gene ENSMUSG00000025572
Gene Nametransmembrane channel-like gene family 6
SynonymsD11Ertd204e, EVER1
MMRRC Submission 041616-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4049 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location117765988-117782198 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 117778261 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 89 (T89I)
Ref Sequence ENSEMBL: ENSMUSP00000123264 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026659] [ENSMUST00000050874] [ENSMUST00000103025] [ENSMUST00000106334] [ENSMUST00000117781] [ENSMUST00000119455] [ENSMUST00000127080] [ENSMUST00000127227] [ENSMUST00000131606] [ENSMUST00000136729] [ENSMUST00000143406] [ENSMUST00000152304]
Predicted Effect possibly damaging
Transcript: ENSMUST00000026659
AA Change: T137I

PolyPhen 2 Score 0.605 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000026659
Gene: ENSMUSG00000025572
AA Change: T137I

DomainStartEndE-ValueType
low complexity region 47 58 N/A INTRINSIC
low complexity region 106 116 N/A INTRINSIC
transmembrane domain 204 226 N/A INTRINSIC
transmembrane domain 254 276 N/A INTRINSIC
transmembrane domain 338 360 N/A INTRINSIC
transmembrane domain 430 452 N/A INTRINSIC
transmembrane domain 467 489 N/A INTRINSIC
Pfam:TMC 539 645 1.5e-40 PFAM
transmembrane domain 650 672 N/A INTRINSIC
transmembrane domain 717 739 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000050874
SMART Domains Protein: ENSMUSP00000051878
Gene: ENSMUSG00000050106

DomainStartEndE-ValueType
transmembrane domain 120 142 N/A INTRINSIC
transmembrane domain 203 225 N/A INTRINSIC
transmembrane domain 301 323 N/A INTRINSIC
transmembrane domain 376 398 N/A INTRINSIC
Pfam:TMC 422 532 3.1e-42 PFAM
transmembrane domain 536 558 N/A INTRINSIC
transmembrane domain 597 619 N/A INTRINSIC
low complexity region 650 666 N/A INTRINSIC
low complexity region 673 686 N/A INTRINSIC
low complexity region 689 712 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000103025
AA Change: T137I

PolyPhen 2 Score 0.605 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000099314
Gene: ENSMUSG00000025572
AA Change: T137I

DomainStartEndE-ValueType
low complexity region 47 58 N/A INTRINSIC
low complexity region 106 116 N/A INTRINSIC
transmembrane domain 204 226 N/A INTRINSIC
transmembrane domain 254 276 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000106334
SMART Domains Protein: ENSMUSP00000101941
Gene: ENSMUSG00000050106

DomainStartEndE-ValueType
transmembrane domain 120 142 N/A INTRINSIC
transmembrane domain 204 226 N/A INTRINSIC
transmembrane domain 302 324 N/A INTRINSIC
transmembrane domain 377 399 N/A INTRINSIC
Pfam:TMC 423 533 6e-41 PFAM
transmembrane domain 537 559 N/A INTRINSIC
transmembrane domain 598 620 N/A INTRINSIC
low complexity region 651 667 N/A INTRINSIC
low complexity region 674 687 N/A INTRINSIC
low complexity region 690 713 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000117781
SMART Domains Protein: ENSMUSP00000113570
Gene: ENSMUSG00000050106

DomainStartEndE-ValueType
transmembrane domain 120 142 N/A INTRINSIC
transmembrane domain 203 225 N/A INTRINSIC
transmembrane domain 301 323 N/A INTRINSIC
transmembrane domain 376 398 N/A INTRINSIC
Pfam:TMC 422 532 1.2e-42 PFAM
transmembrane domain 536 558 N/A INTRINSIC
transmembrane domain 597 619 N/A INTRINSIC
low complexity region 650 666 N/A INTRINSIC
low complexity region 673 686 N/A INTRINSIC
low complexity region 689 712 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000119455
SMART Domains Protein: ENSMUSP00000113628
Gene: ENSMUSG00000050106

DomainStartEndE-ValueType
transmembrane domain 120 142 N/A INTRINSIC
transmembrane domain 204 226 N/A INTRINSIC
transmembrane domain 302 324 N/A INTRINSIC
transmembrane domain 377 399 N/A INTRINSIC
Pfam:TMC 423 533 2.5e-42 PFAM
transmembrane domain 537 559 N/A INTRINSIC
transmembrane domain 598 620 N/A INTRINSIC
low complexity region 651 667 N/A INTRINSIC
low complexity region 674 687 N/A INTRINSIC
low complexity region 690 713 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000127080
SMART Domains Protein: ENSMUSP00000115270
Gene: ENSMUSG00000050106

DomainStartEndE-ValueType
transmembrane domain 120 142 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000127227
Predicted Effect possibly damaging
Transcript: ENSMUST00000131606
AA Change: T89I

PolyPhen 2 Score 0.883 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000123264
Gene: ENSMUSG00000025572
AA Change: T89I

DomainStartEndE-ValueType
low complexity region 58 68 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000136729
SMART Domains Protein: ENSMUSP00000118068
Gene: ENSMUSG00000025572

DomainStartEndE-ValueType
low complexity region 47 58 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000143406
AA Change: T137I

PolyPhen 2 Score 0.598 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000117566
Gene: ENSMUSG00000025572
AA Change: T137I

DomainStartEndE-ValueType
low complexity region 47 58 N/A INTRINSIC
low complexity region 106 116 N/A INTRINSIC
low complexity region 210 226 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000152304
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.6%
Validation Efficiency 100% (65/65)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Epidermodysplasia verruciformis (EV) is an autosomal recessive dermatosis characterized by abnormal susceptibility to human papillomaviruses (HPVs) and a high rate of progression to squamous cell carcinoma on sun-exposed skin. EV is caused by mutations in either of two adjacent genes located on chromosome 17q25.3. Both of these genes encode integral membrane proteins that localize to the endoplasmic reticulum and are predicted to form transmembrane channels. This gene encodes a transmembrane channel-like protein with 10 transmembrane domains and 2 leucine zipper motifs. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb5 T A 12: 118,868,669 E1190V probably damaging Het
Arhgef10 A G 8: 14,979,998 T928A probably benign Het
Arhgef10l T A 4: 140,515,451 I836F probably benign Het
Blm T A 7: 80,502,862 T446S probably benign Het
Ccdc63 T A 5: 122,122,750 Q237L probably damaging Het
Cep57l1 G T 10: 41,729,360 R130S probably damaging Het
Clstn2 T G 9: 97,457,560 E786A possibly damaging Het
Col16a1 C T 4: 130,068,752 P540L probably damaging Het
Csf2 A G 11: 54,249,333 F61L probably damaging Het
Ctr9 C T 7: 111,055,543 R1094C unknown Het
Cyp3a41a A G 5: 145,713,540 C98R probably damaging Het
Dthd1 T A 5: 62,827,165 C404* probably null Het
Egfem1 A C 3: 29,686,731 H518P probably benign Het
Elf3 T C 1: 135,254,277 S369G probably benign Het
Eml6 C T 11: 29,838,577 V503M probably damaging Het
Enthd1 T C 15: 80,560,039 D105G probably damaging Het
Eral1 A G 11: 78,075,602 L250P probably damaging Het
Gdf15 A T 8: 70,629,955 M167K probably benign Het
Ggps1 T C 13: 14,053,699 K300E probably benign Het
Gm8074 G A 9: 78,322,336 noncoding transcript Het
Herc3 A G 6: 58,876,837 I623V probably damaging Het
Mad1l1 A G 5: 140,132,816 S457P probably damaging Het
Map1lc3a G T 2: 155,277,542 V91F possibly damaging Het
Map4k3 A G 17: 80,605,965 V617A probably benign Het
Mov10l1 T A 15: 88,995,032 probably benign Het
Mroh2a A G 1: 88,258,664 S64G probably benign Het
Ncor1 G T 11: 62,329,668 probably null Het
Nfe2 C T 15: 103,250,937 E36K possibly damaging Het
Olfr1176 T C 2: 88,343,800 probably null Het
Olfr1212 A G 2: 88,959,273 K269R probably benign Het
Olfr1251 T C 2: 89,667,662 I75V probably benign Het
Olfr653 T C 7: 104,580,368 F241L probably benign Het
Oprm1 G A 10: 6,829,087 V95I probably benign Het
Pcdha9 T A 18: 36,997,942 H21Q probably benign Het
Pcolce2 A T 9: 95,638,755 I62F probably damaging Het
Pfpl T A 19: 12,429,689 C435S probably damaging Het
Pkhd1l1 G A 15: 44,498,557 C542Y probably damaging Het
Plekha5 T C 6: 140,583,871 S75P probably damaging Het
Pphln1 C A 15: 93,465,106 A202E probably damaging Het
Ppp1r1a A G 15: 103,532,454 L92P probably damaging Het
Prokr2 T C 2: 132,381,494 T43A probably benign Het
Rai14 T C 15: 10,592,212 N199S probably benign Het
Rasgrp2 T C 19: 6,404,727 L199P probably damaging Het
Rnf213 A C 11: 119,482,448 M4939L possibly damaging Het
Slc23a2 C T 2: 132,060,683 R533Q probably benign Het
Slc7a7 T C 14: 54,373,091 probably null Het
Snrpd2 T A 7: 19,151,307 V31E probably damaging Het
Spire1 G T 18: 67,529,031 probably null Het
Srsf4 T C 4: 131,900,543 probably benign Het
Tcf20 A G 15: 82,853,429 S1274P probably damaging Het
Tcof1 C A 18: 60,832,903 A376S possibly damaging Het
Thsd1 T A 8: 22,243,164 Y76N possibly damaging Het
Timm44 A G 8: 4,260,561 V397A probably benign Het
Trbv31 C A 6: 41,557,705 C107F probably damaging Het
Trim37 T A 11: 87,140,603 probably null Het
Ttll5 T C 12: 86,012,799 V1226A probably benign Het
Ube3b T C 5: 114,412,870 V865A probably benign Het
Vmn2r86 A T 10: 130,447,097 M550K probably damaging Het
Vps54 C A 11: 21,300,183 T373N probably benign Het
Wdr64 T G 1: 175,805,856 I891S probably benign Het
Wisp2 A G 2: 163,828,984 D137G probably damaging Het
Zfhx4 C T 3: 5,398,859 S1384L probably damaging Het
Zfp703 A G 8: 26,979,085 E259G possibly damaging Het
Zfp933 T C 4: 147,826,512 H209R probably damaging Het
Zfp980 A G 4: 145,702,600 H633R probably damaging Het
Other mutations in Tmc6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00763:Tmc6 APN 11 117779046 missense probably damaging 0.99
IGL02637:Tmc6 APN 11 117767590 missense possibly damaging 0.94
PIT4520001:Tmc6 UTSW 11 117772730 missense possibly damaging 0.55
R0140:Tmc6 UTSW 11 117766251 unclassified probably benign
R0149:Tmc6 UTSW 11 117769448 missense probably damaging 1.00
R0437:Tmc6 UTSW 11 117778261 missense possibly damaging 0.88
R1566:Tmc6 UTSW 11 117769436 missense probably damaging 0.99
R2011:Tmc6 UTSW 11 117769406 missense probably damaging 1.00
R2012:Tmc6 UTSW 11 117769406 missense probably damaging 1.00
R2169:Tmc6 UTSW 11 117769106 missense probably damaging 1.00
R2568:Tmc6 UTSW 11 117772820 missense probably benign 0.08
R3853:Tmc6 UTSW 11 117773058 nonsense probably null
R4655:Tmc6 UTSW 11 117773042 missense possibly damaging 0.62
R4708:Tmc6 UTSW 11 117768948 missense probably benign 0.00
R5001:Tmc6 UTSW 11 117770784 missense probably benign 0.28
R5115:Tmc6 UTSW 11 117775188 missense probably damaging 0.98
R5551:Tmc6 UTSW 11 117769445 missense probably damaging 1.00
R5667:Tmc6 UTSW 11 117775615 missense possibly damaging 0.87
R5671:Tmc6 UTSW 11 117775615 missense possibly damaging 0.87
R5763:Tmc6 UTSW 11 117769433 missense possibly damaging 0.90
R6137:Tmc6 UTSW 11 117776328 missense probably damaging 1.00
R6354:Tmc6 UTSW 11 117774236 missense probably benign 0.32
R6418:Tmc6 UTSW 11 117770500 missense probably damaging 0.99
R6868:Tmc6 UTSW 11 117774317 missense probably benign 0.01
R7006:Tmc6 UTSW 11 117774257 missense probably damaging 0.96
R7208:Tmc6 UTSW 11 117776325 missense probably benign 0.41
R7210:Tmc6 UTSW 11 117775844 missense possibly damaging 0.59
R7633:Tmc6 UTSW 11 117769220 missense probably benign
Z1177:Tmc6 UTSW 11 117778747 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- TGGGGTTTAAATACCAGCCC -3'
(R):5'- TGAGAACTTTTCAGAAGGGCATG -3'

Sequencing Primer
(F):5'- AGCCCTGGAAAAGACCTCGG -3'
(R):5'- CTTTTCAGAAGGGCATGAGGCTAG -3'
Posted On2015-04-30