Mutagenetix > Incidental Mutation

Incidental Mutation 'R4049:Rnf213'

314057

Institutional Source

Beutler Lab

Gene Symbol

Rnf213

Ensembl Gene

ENSMUSG00000070327

Gene Name

ring finger protein 213

Synonyms

D11Ertd759e

MMRRC Submission

041616-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R4049 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

119393100-119487418 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to C at 119482448 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Methionine to Leucine at position 4939 (M4939L)

Ref Sequence

ENSEMBL: ENSMUSP00000091429 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000093902] [ENSMUST00000131035] [ENSMUST00000172235]

AlphaFold

no structure available at present

Predicted Effect

possibly damaging
Transcript: ENSMUST00000093902
AA Change: M4939L

PolyPhen 2 Score 0.667 (Sensitivity: 0.86; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000091429
Gene: ENSMUSG00000070327
AA Change: M4939L

Domain	Start	End	E-Value	Type
low complexity region	130	146	N/A	INTRINSIC
low complexity region	265	279	N/A	INTRINSIC
low complexity region	319	335	N/A	INTRINSIC
low complexity region	676	688	N/A	INTRINSIC
low complexity region	1114	1128	N/A	INTRINSIC
low complexity region	1546	1558	N/A	INTRINSIC
AAA	2373	2515	2.82e-2	SMART
AAA	2722	2890	3.63e-1	SMART
low complexity region	3449	3459	N/A	INTRINSIC
RING	3947	3985	8.69e-5	SMART
Blast:PP2Ac	4544	4722	3e-66	BLAST

Predicted Effect

probably benign
Transcript: ENSMUST00000131035
AA Change: M4938L

PolyPhen 2 Score 0.019 (Sensitivity: 0.95; Specificity: 0.80)

SMART Domains

Protein: ENSMUSP00000115063
Gene: ENSMUSG00000070327
AA Change: M4938L

Domain	Start	End	E-Value	Type
low complexity region	130	146	N/A	INTRINSIC
low complexity region	265	279	N/A	INTRINSIC
low complexity region	319	335	N/A	INTRINSIC
low complexity region	676	688	N/A	INTRINSIC
low complexity region	1113	1127	N/A	INTRINSIC
low complexity region	1545	1557	N/A	INTRINSIC
AAA	2372	2514	2.82e-2	SMART
AAA	2721	2889	3.63e-1	SMART
low complexity region	3448	3458	N/A	INTRINSIC
RING	3946	3984	8.69e-5	SMART
Blast:PP2Ac	4542	4720	3e-66	BLAST

Predicted Effect

probably benign
Transcript: ENSMUST00000172235
AA Change: M99L

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000207133

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000207273

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000207446

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000208152

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000208476

Meta Mutation Damage Score

0.0749

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.1%
20x: 94.6%

Validation Efficiency

100% (65/65)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein containing a C3HC4-type RING finger domain, which is a specialized type of Zn-finger that binds two atoms of zinc and is thought to be involved in mediating protein-protein interactions. The protein also contains an AAA domain, which is associated with ATPase activity. This gene is a susceptibility gene for Moyamoya disease, a vascular disorder of intracranial arteries. This gene is also a translocation partner in anaplastic large cell lymphoma and inflammatory myofibroblastic tumor cases, where a t(2;17)(p23;q25) translocation has been identified with the anaplastic lymphoma kinase (ALK) gene on chromosome 2, and a t(8;17)(q24;q25) translocation has been identified with the MYC gene on chromosome 8. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2011]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit decreased body weight and circulating glucose level but normal glucose tolerance, insulin sensitivity, insulin plasma levels and leptin plasma levels. [provided by MGI curators]

Allele List at MGI

All alleles(13) : Targeted, other(2) Gene trapped(11)

Other mutations in this stock

Total: 65 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcb5	T	A	12: 118,868,669 (GRCm38)	E1190V	probably damaging	Het
Arhgef10	A	G	8: 14,979,998 (GRCm38)	T928A	probably benign	Het
Arhgef10l	T	A	4: 140,515,451 (GRCm38)	I836F	probably benign	Het
Blm	T	A	7: 80,502,862 (GRCm38)	T446S	probably benign	Het
Ccdc63	T	A	5: 122,122,750 (GRCm38)	Q237L	probably damaging	Het
Ccn5	A	G	2: 163,828,984 (GRCm38)	D137G	probably damaging	Het
Cep57l1	G	T	10: 41,729,360 (GRCm38)	R130S	probably damaging	Het
Clstn2	T	G	9: 97,457,560 (GRCm38)	E786A	possibly damaging	Het
Col16a1	C	T	4: 130,068,752 (GRCm38)	P540L	probably damaging	Het
Csf2	A	G	11: 54,249,333 (GRCm38)	F61L	probably damaging	Het
Ctr9	C	T	7: 111,055,543 (GRCm38)	R1094C	unknown	Het
Cyp3a41a	A	G	5: 145,713,540 (GRCm38)	C98R	probably damaging	Het
Dthd1	T	A	5: 62,827,165 (GRCm38)	C404*	probably null	Het
Egfem1	A	C	3: 29,686,731 (GRCm38)	H518P	probably benign	Het
Elf3	T	C	1: 135,254,277 (GRCm38)	S369G	probably benign	Het
Eml6	C	T	11: 29,838,577 (GRCm38)	V503M	probably damaging	Het
Enthd1	T	C	15: 80,560,039 (GRCm38)	D105G	probably damaging	Het
Eral1	A	G	11: 78,075,602 (GRCm38)	L250P	probably damaging	Het
Gdf15	A	T	8: 70,629,955 (GRCm38)	M167K	probably benign	Het
Ggps1	T	C	13: 14,053,699 (GRCm38)	K300E	probably benign	Het
Gm8074	G	A	9: 78,322,336 (GRCm38)		noncoding transcript	Het
Herc3	A	G	6: 58,876,837 (GRCm38)	I623V	probably damaging	Het
Mad1l1	A	G	5: 140,132,816 (GRCm38)	S457P	probably damaging	Het
Map1lc3a	G	T	2: 155,277,542 (GRCm38)	V91F	possibly damaging	Het
Map4k3	A	G	17: 80,605,965 (GRCm38)	V617A	probably benign	Het
Mov10l1	T	A	15: 88,995,032 (GRCm38)		probably benign	Het
Mroh2a	A	G	1: 88,258,664 (GRCm38)	S64G	probably benign	Het
Ncor1	G	T	11: 62,329,668 (GRCm38)		probably null	Het
Nfe2	C	T	15: 103,250,937 (GRCm38)	E36K	possibly damaging	Het
Oprm1	G	A	10: 6,829,087 (GRCm38)	V95I	probably benign	Het
Or4a78	T	C	2: 89,667,662 (GRCm38)	I75V	probably benign	Het
Or4c107	A	G	2: 88,959,273 (GRCm38)	K269R	probably benign	Het
Or52d3	T	C	7: 104,580,368 (GRCm38)	F241L	probably benign	Het
Or5d46	T	C	2: 88,343,800 (GRCm38)		probably null	Het
Pcdha9	T	A	18: 36,997,942 (GRCm38)	H21Q	probably benign	Het
Pcolce2	A	T	9: 95,638,755 (GRCm38)	I62F	probably damaging	Het
Pfpl	T	A	19: 12,429,689 (GRCm38)	C435S	probably damaging	Het
Pkhd1l1	G	A	15: 44,498,557 (GRCm38)	C542Y	probably damaging	Het
Plekha5	T	C	6: 140,583,871 (GRCm38)	S75P	probably damaging	Het
Pphln1	C	A	15: 93,465,106 (GRCm38)	A202E	probably damaging	Het
Ppp1r1a	A	G	15: 103,532,454 (GRCm38)	L92P	probably damaging	Het
Prokr2	T	C	2: 132,381,494 (GRCm38)	T43A	probably benign	Het
Rai14	T	C	15: 10,592,212 (GRCm38)	N199S	probably benign	Het
Rasgrp2	T	C	19: 6,404,727 (GRCm38)	L199P	probably damaging	Het
Slc23a2	C	T	2: 132,060,683 (GRCm38)	R533Q	probably benign	Het
Slc7a7	T	C	14: 54,373,091 (GRCm38)		probably null	Het
Snrpd2	T	A	7: 19,151,307 (GRCm38)	V31E	probably damaging	Het
Spire1	G	T	18: 67,529,031 (GRCm38)		probably null	Het
Srsf4	T	C	4: 131,900,543 (GRCm38)		probably benign	Het
Tcf20	A	G	15: 82,853,429 (GRCm38)	S1274P	probably damaging	Het
Tcof1	C	A	18: 60,832,903 (GRCm38)	A376S	possibly damaging	Het
Thsd1	T	A	8: 22,243,164 (GRCm38)	Y76N	possibly damaging	Het
Timm44	A	G	8: 4,260,561 (GRCm38)	V397A	probably benign	Het
Tmc6	G	A	11: 117,778,261 (GRCm38)	T89I	possibly damaging	Het
Trbv31	C	A	6: 41,557,705 (GRCm38)	C107F	probably damaging	Het
Trim37	T	A	11: 87,140,603 (GRCm38)		probably null	Het
Ttll5	T	C	12: 86,012,799 (GRCm38)	V1226A	probably benign	Het
Ube3b	T	C	5: 114,412,870 (GRCm38)	V865A	probably benign	Het
Vmn2r86	A	T	10: 130,447,097 (GRCm38)	M550K	probably damaging	Het
Vps54	C	A	11: 21,300,183 (GRCm38)	T373N	probably benign	Het
Wdr64	T	G	1: 175,805,856 (GRCm38)	I891S	probably benign	Het
Zfhx4	C	T	3: 5,398,859 (GRCm38)	S1384L	probably damaging	Het
Zfp703	A	G	8: 26,979,085 (GRCm38)	E259G	possibly damaging	Het
Zfp933	T	C	4: 147,826,512 (GRCm38)	H209R	probably damaging	Het
Zfp980	A	G	4: 145,702,600 (GRCm38)	H633R	probably damaging	Het

Other mutations in Rnf213

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00336:Rnf213	APN	11	119,449,343 (GRCm38)	missense	probably benign	0.00
IGL00961:Rnf213	APN	11	119,440,843 (GRCm38)	missense	possibly damaging	0.55
IGL01324:Rnf213	APN	11	119,447,237 (GRCm38)	missense	probably damaging	1.00
IGL01351:Rnf213	APN	11	119,483,118 (GRCm38)	missense	probably benign	0.25
IGL01403:Rnf213	APN	11	119,443,300 (GRCm38)	missense	probably damaging	1.00
IGL01704:Rnf213	APN	11	119,449,876 (GRCm38)	critical splice donor site	probably null
IGL01765:Rnf213	APN	11	119,436,352 (GRCm38)	missense	probably benign	0.00
IGL01803:Rnf213	APN	11	119,441,307 (GRCm38)	missense	probably damaging	1.00
IGL01804:Rnf213	APN	11	119,442,266 (GRCm38)	missense	probably damaging	1.00
IGL01900:Rnf213	APN	11	119,443,015 (GRCm38)	missense	probably benign	0.05
IGL01944:Rnf213	APN	11	119,416,457 (GRCm38)	missense	probably benign	0.01
IGL01982:Rnf213	APN	11	119,443,268 (GRCm38)	missense	probably damaging	1.00
IGL02008:Rnf213	APN	11	119,418,309 (GRCm38)	splice site	probably benign
IGL02084:Rnf213	APN	11	119,445,673 (GRCm38)	missense	probably benign	0.04
IGL02253:Rnf213	APN	11	119,440,650 (GRCm38)	missense	probably benign	0.03
IGL02254:Rnf213	APN	11	119,480,907 (GRCm38)	missense	possibly damaging	0.89
IGL02296:Rnf213	APN	11	119,463,336 (GRCm38)	missense	probably benign	0.01
IGL02531:Rnf213	APN	11	119,436,802 (GRCm38)	missense	probably benign
IGL02588:Rnf213	APN	11	119,416,536 (GRCm38)	missense	probably benign	0.30
IGL02615:Rnf213	APN	11	119,440,789 (GRCm38)	missense	probably damaging	0.96
IGL02805:Rnf213	APN	11	119,435,066 (GRCm38)	missense	probably damaging	0.99
IGL02887:Rnf213	APN	11	119,427,510 (GRCm38)	missense	probably damaging	1.00
IGL03001:Rnf213	APN	11	119,479,941 (GRCm38)	missense	probably damaging	1.00
IGL03035:Rnf213	APN	11	119,445,626 (GRCm38)	splice site	probably benign
IGL03057:Rnf213	APN	11	119,441,087 (GRCm38)	missense	probably damaging	1.00
IGL03148:Rnf213	APN	11	119,465,007 (GRCm38)	missense	probably damaging	1.00
IGL03308:Rnf213	APN	11	119,474,172 (GRCm38)	missense	probably benign	0.03
IGL03339:Rnf213	APN	11	119,443,004 (GRCm38)	missense	probably damaging	1.00
IGL03369:Rnf213	APN	11	119,421,468 (GRCm38)	missense	probably benign	0.34
attrition	UTSW	11	119,430,321 (GRCm38)	missense	possibly damaging	0.77
defame	UTSW	11	119,430,281 (GRCm38)	nonsense	probably null
Derogate	UTSW	11	119,470,210 (GRCm38)	missense	probably damaging	1.00
dinky	UTSW	11	119,416,458 (GRCm38)	missense	probably damaging	0.99
G1funyon_rnf213_024	UTSW	11	119,434,742 (GRCm38)	missense
Impugn	UTSW	11	119,436,823 (GRCm38)	nonsense	probably null
R4332_Rnf213_642	UTSW	11	119,436,676 (GRCm38)	missense	probably damaging	1.00
B6584:Rnf213	UTSW	11	119,426,069 (GRCm38)	missense	probably damaging	0.97
G1Funyon:Rnf213	UTSW	11	119,434,742 (GRCm38)	missense
PIT4585001:Rnf213	UTSW	11	119,458,392 (GRCm38)	missense
R0008:Rnf213	UTSW	11	119,465,052 (GRCm38)	missense	possibly damaging	0.82
R0015:Rnf213	UTSW	11	119,441,606 (GRCm38)	missense	possibly damaging	0.95
R0041:Rnf213	UTSW	11	119,402,575 (GRCm38)	missense	probably benign	0.41
R0114:Rnf213	UTSW	11	119,414,587 (GRCm38)	missense	probably damaging	1.00
R0131:Rnf213	UTSW	11	119,430,361 (GRCm38)	missense	probably benign	0.10
R0131:Rnf213	UTSW	11	119,430,361 (GRCm38)	missense	probably benign	0.10
R0132:Rnf213	UTSW	11	119,430,361 (GRCm38)	missense	probably benign	0.10
R0138:Rnf213	UTSW	11	119,416,496 (GRCm38)	missense	probably benign	0.05
R0144:Rnf213	UTSW	11	119,479,600 (GRCm38)	nonsense	probably null
R0184:Rnf213	UTSW	11	119,414,521 (GRCm38)	missense	probably damaging	0.99
R0321:Rnf213	UTSW	11	119,438,105 (GRCm38)	nonsense	probably null
R0365:Rnf213	UTSW	11	119,426,111 (GRCm38)	missense	possibly damaging	0.74
R0415:Rnf213	UTSW	11	119,414,469 (GRCm38)	missense	probably damaging	1.00
R0421:Rnf213	UTSW	11	119,447,257 (GRCm38)	missense	probably damaging	1.00
R0494:Rnf213	UTSW	11	119,426,012 (GRCm38)	missense	possibly damaging	0.65
R0494:Rnf213	UTSW	11	119,443,120 (GRCm38)	missense	probably damaging	1.00
R0549:Rnf213	UTSW	11	119,465,082 (GRCm38)	missense	probably damaging	1.00
R0577:Rnf213	UTSW	11	119,443,280 (GRCm38)	missense	probably damaging	1.00
R0605:Rnf213	UTSW	11	119,431,717 (GRCm38)	missense	probably benign	0.03
R0638:Rnf213	UTSW	11	119,470,210 (GRCm38)	missense	probably damaging	1.00
R0675:Rnf213	UTSW	11	119,441,834 (GRCm38)	missense	probably benign	0.28
R0715:Rnf213	UTSW	11	119,441,150 (GRCm38)	missense	probably damaging	0.97
R0732:Rnf213	UTSW	11	119,441,068 (GRCm38)	missense	probably damaging	0.99
R0748:Rnf213	UTSW	11	119,473,480 (GRCm38)	missense	probably damaging	1.00
R0765:Rnf213	UTSW	11	119,423,095 (GRCm38)	critical splice donor site	probably null
R0890:Rnf213	UTSW	11	119,430,486 (GRCm38)	missense	possibly damaging	0.94
R0927:Rnf213	UTSW	11	119,414,570 (GRCm38)	missense	probably benign	0.00
R0940:Rnf213	UTSW	11	119,416,563 (GRCm38)	missense	probably benign	0.10
R0959:Rnf213	UTSW	11	119,452,581 (GRCm38)	missense	probably damaging	0.99
R1077:Rnf213	UTSW	11	119,485,998 (GRCm38)	splice site	probably benign
R1104:Rnf213	UTSW	11	119,477,229 (GRCm38)	missense	probably benign	0.29
R1141:Rnf213	UTSW	11	119,435,983 (GRCm38)	missense	probably benign	0.02
R1219:Rnf213	UTSW	11	119,436,177 (GRCm38)	missense	probably damaging	1.00
R1435:Rnf213	UTSW	11	119,436,005 (GRCm38)	missense	probably damaging	1.00
R1444:Rnf213	UTSW	11	119,442,400 (GRCm38)	missense	probably damaging	1.00
R1474:Rnf213	UTSW	11	119,437,750 (GRCm38)	missense	probably damaging	1.00
R1488:Rnf213	UTSW	11	119,480,889 (GRCm38)	missense	probably benign	0.05
R1523:Rnf213	UTSW	11	119,441,888 (GRCm38)	missense	probably damaging	1.00
R1548:Rnf213	UTSW	11	119,442,707 (GRCm38)	missense	probably damaging	1.00
R1554:Rnf213	UTSW	11	119,441,839 (GRCm38)	missense	probably benign	0.06
R1563:Rnf213	UTSW	11	119,414,526 (GRCm38)	missense	probably benign	0.13
R1572:Rnf213	UTSW	11	119,436,611 (GRCm38)	missense	probably damaging	1.00
R1585:Rnf213	UTSW	11	119,463,345 (GRCm38)	missense	probably damaging	1.00
R1635:Rnf213	UTSW	11	119,442,579 (GRCm38)	missense	probably damaging	0.97
R1663:Rnf213	UTSW	11	119,437,672 (GRCm38)	missense	probably benign	0.01
R1789:Rnf213	UTSW	11	119,440,221 (GRCm38)	missense	probably damaging	0.97
R1844:Rnf213	UTSW	11	119,441,183 (GRCm38)	missense	probably damaging	1.00
R1871:Rnf213	UTSW	11	119,450,129 (GRCm38)	missense	probably benign	0.08
R1893:Rnf213	UTSW	11	119,416,448 (GRCm38)	missense	probably damaging	1.00
R1937:Rnf213	UTSW	11	119,431,685 (GRCm38)	missense	probably damaging	1.00
R1967:Rnf213	UTSW	11	119,480,895 (GRCm38)	missense	probably damaging	1.00
R1987:Rnf213	UTSW	11	119,441,107 (GRCm38)	missense	probably damaging	1.00
R2000:Rnf213	UTSW	11	119,436,022 (GRCm38)	missense	probably damaging	1.00
R2020:Rnf213	UTSW	11	119,461,918 (GRCm38)	missense	probably damaging	0.99
R2100:Rnf213	UTSW	11	119,467,302 (GRCm38)	nonsense	probably null
R2109:Rnf213	UTSW	11	119,442,663 (GRCm38)	nonsense	probably null
R2115:Rnf213	UTSW	11	119,428,013 (GRCm38)	missense	probably benign	0.00
R2126:Rnf213	UTSW	11	119,450,201 (GRCm38)	missense	probably damaging	0.99
R2144:Rnf213	UTSW	11	119,443,690 (GRCm38)	missense	probably damaging	0.99
R2145:Rnf213	UTSW	11	119,415,193 (GRCm38)	missense	probably benign	0.03
R2168:Rnf213	UTSW	11	119,415,070 (GRCm38)	missense	probably damaging	0.97
R2189:Rnf213	UTSW	11	119,430,361 (GRCm38)	missense	probably benign	0.10
R2199:Rnf213	UTSW	11	119,460,009 (GRCm38)	missense	probably benign	0.01
R2220:Rnf213	UTSW	11	119,436,428 (GRCm38)	missense	possibly damaging	0.94
R2336:Rnf213	UTSW	11	119,414,604 (GRCm38)	missense	probably benign	0.02
R2400:Rnf213	UTSW	11	119,443,195 (GRCm38)	missense	probably damaging	1.00
R2679:Rnf213	UTSW	11	119,459,938 (GRCm38)	splice site	probably null
R2698:Rnf213	UTSW	11	119,410,144 (GRCm38)	missense	probably benign	0.26
R3151:Rnf213	UTSW	11	119,468,892 (GRCm38)	missense	probably benign	0.03
R3607:Rnf213	UTSW	11	119,441,976 (GRCm38)	nonsense	probably null
R3808:Rnf213	UTSW	11	119,479,558 (GRCm38)	missense	probably damaging	1.00
R3854:Rnf213	UTSW	11	119,480,939 (GRCm38)	splice site	probably benign
R3856:Rnf213	UTSW	11	119,480,939 (GRCm38)	splice site	probably benign
R3973:Rnf213	UTSW	11	119,469,053 (GRCm38)	missense
R4014:Rnf213	UTSW	11	119,445,729 (GRCm38)	nonsense	probably null
R4130:Rnf213	UTSW	11	119,483,006 (GRCm38)	missense	probably damaging	1.00
R4153:Rnf213	UTSW	11	119,409,482 (GRCm38)	missense	probably benign	0.27
R4167:Rnf213	UTSW	11	119,441,243 (GRCm38)	missense	probably damaging	0.99
R4224:Rnf213	UTSW	11	119,436,823 (GRCm38)	nonsense	probably null
R4332:Rnf213	UTSW	11	119,436,676 (GRCm38)	missense	probably damaging	1.00
R4415:Rnf213	UTSW	11	119,483,964 (GRCm38)	missense	probably damaging	0.99
R4547:Rnf213	UTSW	11	119,479,670 (GRCm38)	critical splice donor site	probably null
R4609:Rnf213	UTSW	11	119,437,695 (GRCm38)	missense	possibly damaging	0.86
R4684:Rnf213	UTSW	11	119,441,125 (GRCm38)	missense	probably damaging	1.00
R4704:Rnf213	UTSW	11	119,440,349 (GRCm38)	missense	probably damaging	1.00
R4719:Rnf213	UTSW	11	119,420,067 (GRCm38)	missense	probably benign	0.38
R4751:Rnf213	UTSW	11	119,445,745 (GRCm38)	missense	probably benign	0.12
R4828:Rnf213	UTSW	11	119,416,629 (GRCm38)	missense	possibly damaging	0.61
R4837:Rnf213	UTSW	11	119,442,763 (GRCm38)	missense	probably benign	0.00
R4894:Rnf213	UTSW	11	119,481,240 (GRCm38)	missense	probably damaging	1.00
R4973:Rnf213	UTSW	11	119,428,157 (GRCm38)	missense	possibly damaging	0.84
R5026:Rnf213	UTSW	11	119,436,764 (GRCm38)	missense	probably damaging	1.00
R5034:Rnf213	UTSW	11	119,410,807 (GRCm38)	missense	probably damaging	0.99
R5284:Rnf213	UTSW	11	119,458,866 (GRCm38)	missense	possibly damaging	0.89
R5295:Rnf213	UTSW	11	119,440,816 (GRCm38)	missense	probably benign	0.00
R5406:Rnf213	UTSW	11	119,440,808 (GRCm38)	missense	probably damaging	1.00
R5441:Rnf213	UTSW	11	119,409,020 (GRCm38)	missense	probably damaging	0.99
R5449:Rnf213	UTSW	11	119,415,076 (GRCm38)	missense	probably benign	0.44
R5520:Rnf213	UTSW	11	119,433,499 (GRCm38)	missense	probably damaging	1.00
R5636:Rnf213	UTSW	11	119,436,905 (GRCm38)	missense	probably damaging	1.00
R5636:Rnf213	UTSW	11	119,436,629 (GRCm38)	missense	probably benign	0.04
R5669:Rnf213	UTSW	11	119,458,785 (GRCm38)	missense	possibly damaging	0.92
R5670:Rnf213	UTSW	11	119,434,686 (GRCm38)	critical splice acceptor site	probably null
R5697:Rnf213	UTSW	11	119,483,894 (GRCm38)	missense	possibly damaging	0.54
R5726:Rnf213	UTSW	11	119,416,458 (GRCm38)	missense	probably damaging	0.99
R5808:Rnf213	UTSW	11	119,436,295 (GRCm38)	missense	probably benign
R5861:Rnf213	UTSW	11	119,473,377 (GRCm38)	missense	probably damaging	1.00
R5903:Rnf213	UTSW	11	119,421,369 (GRCm38)	missense	probably damaging	0.98
R5949:Rnf213	UTSW	11	119,443,079 (GRCm38)	missense	probably damaging	1.00
R6022:Rnf213	UTSW	11	119,486,010 (GRCm38)	missense	probably benign	0.00
R6043:Rnf213	UTSW	11	119,442,101 (GRCm38)	missense	probably damaging	0.97
R6089:Rnf213	UTSW	11	119,416,559 (GRCm38)	missense	probably benign	0.14
R6123:Rnf213	UTSW	11	119,411,513 (GRCm38)	missense	probably damaging	0.96
R6134:Rnf213	UTSW	11	119,411,470 (GRCm38)	missense	probably damaging	0.99
R6135:Rnf213	UTSW	11	119,442,028 (GRCm38)	missense	probably benign	0.02
R6146:Rnf213	UTSW	11	119,435,999 (GRCm38)	missense	probably benign	0.41
R6163:Rnf213	UTSW	11	119,458,428 (GRCm38)	missense	possibly damaging	0.86
R6272:Rnf213	UTSW	11	119,414,548 (GRCm38)	missense	probably damaging	1.00
R6333:Rnf213	UTSW	11	119,463,366 (GRCm38)	missense	probably damaging	1.00
R6370:Rnf213	UTSW	11	119,477,078 (GRCm38)	missense	probably damaging	0.99
R6456:Rnf213	UTSW	11	119,459,966 (GRCm38)	missense	probably benign	0.03
R6468:Rnf213	UTSW	11	119,452,687 (GRCm38)	missense	possibly damaging	0.94
R6579:Rnf213	UTSW	11	119,436,280 (GRCm38)	missense	probably damaging	0.96
R6648:Rnf213	UTSW	11	119,479,920 (GRCm38)	missense	possibly damaging	0.81
R6727:Rnf213	UTSW	11	119,430,321 (GRCm38)	missense	possibly damaging	0.77
R6739:Rnf213	UTSW	11	119,442,271 (GRCm38)	missense	probably damaging	1.00
R6768:Rnf213	UTSW	11	119,442,236 (GRCm38)	missense	probably damaging	0.99
R6817:Rnf213	UTSW	11	119,462,285 (GRCm38)	critical splice donor site	probably null
R6820:Rnf213	UTSW	11	119,448,838 (GRCm38)	missense	probably damaging	1.00
R6841:Rnf213	UTSW	11	119,449,866 (GRCm38)	missense	probably benign	0.26
R6934:Rnf213	UTSW	11	119,420,067 (GRCm38)	missense	probably benign	0.38
R7026:Rnf213	UTSW	11	119,479,655 (GRCm38)	missense	possibly damaging	0.58
R7094:Rnf213	UTSW	11	119,437,604 (GRCm38)	splice site	probably null
R7170:Rnf213	UTSW	11	119,452,575 (GRCm38)	missense
R7185:Rnf213	UTSW	11	119,424,198 (GRCm38)	missense
R7239:Rnf213	UTSW	11	119,458,788 (GRCm38)	missense
R7258:Rnf213	UTSW	11	119,452,575 (GRCm38)	missense
R7259:Rnf213	UTSW	11	119,452,575 (GRCm38)	missense
R7260:Rnf213	UTSW	11	119,452,575 (GRCm38)	missense
R7273:Rnf213	UTSW	11	119,431,756 (GRCm38)	splice site	probably null
R7282:Rnf213	UTSW	11	119,437,992 (GRCm38)	missense
R7311:Rnf213	UTSW	11	119,416,547 (GRCm38)	missense
R7352:Rnf213	UTSW	11	119,443,579 (GRCm38)	missense
R7369:Rnf213	UTSW	11	119,430,468 (GRCm38)	missense
R7410:Rnf213	UTSW	11	119,435,051 (GRCm38)	missense
R7448:Rnf213	UTSW	11	119,481,291 (GRCm38)	missense
R7561:Rnf213	UTSW	11	119,441,719 (GRCm38)	missense
R7573:Rnf213	UTSW	11	119,458,484 (GRCm38)	missense
R7615:Rnf213	UTSW	11	119,467,297 (GRCm38)	missense
R7680:Rnf213	UTSW	11	119,479,556 (GRCm38)	missense
R7739:Rnf213	UTSW	11	119,410,861 (GRCm38)	missense
R7789:Rnf213	UTSW	11	119,470,219 (GRCm38)	splice site	probably null
R7806:Rnf213	UTSW	11	119,411,545 (GRCm38)	missense
R8031:Rnf213	UTSW	11	119,430,281 (GRCm38)	nonsense	probably null
R8042:Rnf213	UTSW	11	119,441,654 (GRCm38)	missense
R8053:Rnf213	UTSW	11	119,402,647 (GRCm38)	missense
R8284:Rnf213	UTSW	11	119,428,083 (GRCm38)	missense
R8301:Rnf213	UTSW	11	119,434,742 (GRCm38)	missense
R8325:Rnf213	UTSW	11	119,430,445 (GRCm38)	missense
R8332:Rnf213	UTSW	11	119,483,698 (GRCm38)	missense
R8443:Rnf213	UTSW	11	119,449,323 (GRCm38)	missense
R8518:Rnf213	UTSW	11	119,462,217 (GRCm38)	missense
R8531:Rnf213	UTSW	11	119,474,205 (GRCm38)	missense	probably benign	0.02
R8670:Rnf213	UTSW	11	119,458,737 (GRCm38)	missense
R8675:Rnf213	UTSW	11	119,456,158 (GRCm38)	missense
R8690:Rnf213	UTSW	11	119,441,212 (GRCm38)	missense
R8690:Rnf213	UTSW	11	119,418,129 (GRCm38)	missense
R8714:Rnf213	UTSW	11	119,468,894 (GRCm38)	missense
R8802:Rnf213	UTSW	11	119,462,102 (GRCm38)	missense
R8861:Rnf213	UTSW	11	119,442,236 (GRCm38)	missense
R8886:Rnf213	UTSW	11	119,473,438 (GRCm38)	missense
R8893:Rnf213	UTSW	11	119,443,042 (GRCm38)	missense
R8937:Rnf213	UTSW	11	119,430,274 (GRCm38)	missense	possibly damaging	0.94
R8941:Rnf213	UTSW	11	119,414,424 (GRCm38)	missense	probably damaging	1.00
R8973:Rnf213	UTSW	11	119,461,930 (GRCm38)	missense
R8983:Rnf213	UTSW	11	119,430,349 (GRCm38)	missense
R9043:Rnf213	UTSW	11	119,458,913 (GRCm38)	missense
R9081:Rnf213	UTSW	11	119,466,236 (GRCm38)	missense
R9132:Rnf213	UTSW	11	119,483,916 (GRCm38)	missense
R9135:Rnf213	UTSW	11	119,408,747 (GRCm38)	missense
R9146:Rnf213	UTSW	11	119,443,673 (GRCm38)	missense
R9156:Rnf213	UTSW	11	119,440,748 (GRCm38)	missense
R9183:Rnf213	UTSW	11	119,427,622 (GRCm38)	missense
R9234:Rnf213	UTSW	11	119,450,117 (GRCm38)	missense
R9275:Rnf213	UTSW	11	119,435,942 (GRCm38)	missense
R9278:Rnf213	UTSW	11	119,435,942 (GRCm38)	missense
R9296:Rnf213	UTSW	11	119,443,795 (GRCm38)	splice site	probably benign
R9350:Rnf213	UTSW	11	119,442,149 (GRCm38)	missense
R9366:Rnf213	UTSW	11	119,436,231 (GRCm38)	missense
R9413:Rnf213	UTSW	11	119,466,233 (GRCm38)	missense
R9444:Rnf213	UTSW	11	119,434,797 (GRCm38)	missense
R9464:Rnf213	UTSW	11	119,463,580 (GRCm38)	missense
R9605:Rnf213	UTSW	11	119,469,053 (GRCm38)	missense
R9649:Rnf213	UTSW	11	119,479,631 (GRCm38)	missense
R9651:Rnf213	UTSW	11	119,440,412 (GRCm38)	missense
R9664:Rnf213	UTSW	11	119,441,968 (GRCm38)	missense
R9696:Rnf213	UTSW	11	119,468,980 (GRCm38)	missense
R9710:Rnf213	UTSW	11	119,441,005 (GRCm38)	missense
R9797:Rnf213	UTSW	11	119,442,539 (GRCm38)	missense
S24628:Rnf213	UTSW	11	119,414,469 (GRCm38)	missense	probably damaging	1.00
X0021:Rnf213	UTSW	11	119,441,824 (GRCm38)	missense	probably benign	0.14
X0062:Rnf213	UTSW	11	119,473,513 (GRCm38)	missense	probably benign	0.05
X0064:Rnf213	UTSW	11	119,440,463 (GRCm38)	missense	probably damaging	1.00
Z1088:Rnf213	UTSW	11	119,477,254 (GRCm38)	missense	possibly damaging	0.69
Z1176:Rnf213	UTSW	11	119,482,998 (GRCm38)	missense
Z1176:Rnf213	UTSW	11	119,441,410 (GRCm38)	missense

Predicted Primers

PCR Primer
(F):5'- TCTTCAGCATAGACATCCTGGG -3'
(R):5'- TCCTTTGTGGAAAGCACTGGAC -3'

Sequencing Primer
(F):5'- CTGCGGGCTTTACCAGAAATGTC -3'
(R):5'- CTCACAGGAGTCTCAGGATTC -3'

Posted On

2015-04-30