Mutagenetix > Incidental Mutation

Incidental Mutation 'R4049:Abcb5'

314059

Institutional Source

Beutler Lab

Gene Symbol

Abcb5

Ensembl Gene

ENSMUSG00000072791

Gene Name

ATP-binding cassette, sub-family B (MDR/TAP), member 5

Synonyms

9230106F14Rik

MMRRC Submission

041616-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.215) question?

Stock #

R4049 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

118867824-118966421 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 118868669 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Valine at position 1190 (E1190V)

Ref Sequence

ENSEMBL: ENSMUSP00000046177 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000035515]

AlphaFold

B5X0E4

Predicted Effect

probably damaging
Transcript: ENSMUST00000035515
AA Change: E1190V

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000046177
Gene: ENSMUSG00000072791
AA Change: E1190V

Domain	Start	End	E-Value	Type
Pfam:ABC_membrane	49	338	1.9e-74	PFAM
AAA	414	606	2.1e-19	SMART
Pfam:ABC_membrane	693	967	7.3e-59	PFAM
Blast:AAA	969	1040	2e-11	BLAST
AAA	1043	1231	8.26e-18	SMART

Meta Mutation Damage Score

0.6467

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.1%
20x: 94.6%

Validation Efficiency

100% (65/65)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] ABCB5 belongs to the ATP-binding cassette (ABC) transporter superfamily of integral membrane proteins. These proteins participate in ATP-dependent transmembrane transport of structurally diverse molecules ranging from small ions, sugars, and peptides to more complex organic molecules (Chen et al., 2005 [PubMed 15760339]).[supplied by OMIM, Mar 2008]

Allele List at MGI

Other mutations in this stock

Total: 65 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Arhgef10	A	G	8: 14,979,998	T928A	probably benign	Het
Arhgef10l	T	A	4: 140,515,451	I836F	probably benign	Het
Blm	T	A	7: 80,502,862	T446S	probably benign	Het
Ccdc63	T	A	5: 122,122,750	Q237L	probably damaging	Het
Cep57l1	G	T	10: 41,729,360	R130S	probably damaging	Het
Clstn2	T	G	9: 97,457,560	E786A	possibly damaging	Het
Col16a1	C	T	4: 130,068,752	P540L	probably damaging	Het
Csf2	A	G	11: 54,249,333	F61L	probably damaging	Het
Ctr9	C	T	7: 111,055,543	R1094C	unknown	Het
Cyp3a41a	A	G	5: 145,713,540	C98R	probably damaging	Het
Dthd1	T	A	5: 62,827,165	C404*	probably null	Het
Egfem1	A	C	3: 29,686,731	H518P	probably benign	Het
Elf3	T	C	1: 135,254,277	S369G	probably benign	Het
Eml6	C	T	11: 29,838,577	V503M	probably damaging	Het
Enthd1	T	C	15: 80,560,039	D105G	probably damaging	Het
Eral1	A	G	11: 78,075,602	L250P	probably damaging	Het
Gdf15	A	T	8: 70,629,955	M167K	probably benign	Het
Ggps1	T	C	13: 14,053,699	K300E	probably benign	Het
Gm8074	G	A	9: 78,322,336		noncoding transcript	Het
Herc3	A	G	6: 58,876,837	I623V	probably damaging	Het
Mad1l1	A	G	5: 140,132,816	S457P	probably damaging	Het
Map1lc3a	G	T	2: 155,277,542	V91F	possibly damaging	Het
Map4k3	A	G	17: 80,605,965	V617A	probably benign	Het
Mov10l1	T	A	15: 88,995,032		probably benign	Het
Mroh2a	A	G	1: 88,258,664	S64G	probably benign	Het
Ncor1	G	T	11: 62,329,668		probably null	Het
Nfe2	C	T	15: 103,250,937	E36K	possibly damaging	Het
Olfr1176	T	C	2: 88,343,800		probably null	Het
Olfr1212	A	G	2: 88,959,273	K269R	probably benign	Het
Olfr1251	T	C	2: 89,667,662	I75V	probably benign	Het
Olfr653	T	C	7: 104,580,368	F241L	probably benign	Het
Oprm1	G	A	10: 6,829,087	V95I	probably benign	Het
Pcdha9	T	A	18: 36,997,942	H21Q	probably benign	Het
Pcolce2	A	T	9: 95,638,755	I62F	probably damaging	Het
Pfpl	T	A	19: 12,429,689	C435S	probably damaging	Het
Pkhd1l1	G	A	15: 44,498,557	C542Y	probably damaging	Het
Plekha5	T	C	6: 140,583,871	S75P	probably damaging	Het
Pphln1	C	A	15: 93,465,106	A202E	probably damaging	Het
Ppp1r1a	A	G	15: 103,532,454	L92P	probably damaging	Het
Prokr2	T	C	2: 132,381,494	T43A	probably benign	Het
Rai14	T	C	15: 10,592,212	N199S	probably benign	Het
Rasgrp2	T	C	19: 6,404,727	L199P	probably damaging	Het
Rnf213	A	C	11: 119,482,448	M4939L	possibly damaging	Het
Slc23a2	C	T	2: 132,060,683	R533Q	probably benign	Het
Slc7a7	T	C	14: 54,373,091		probably null	Het
Snrpd2	T	A	7: 19,151,307	V31E	probably damaging	Het
Spire1	G	T	18: 67,529,031		probably null	Het
Srsf4	T	C	4: 131,900,543		probably benign	Het
Tcf20	A	G	15: 82,853,429	S1274P	probably damaging	Het
Tcof1	C	A	18: 60,832,903	A376S	possibly damaging	Het
Thsd1	T	A	8: 22,243,164	Y76N	possibly damaging	Het
Timm44	A	G	8: 4,260,561	V397A	probably benign	Het
Tmc6	G	A	11: 117,778,261	T89I	possibly damaging	Het
Trbv31	C	A	6: 41,557,705	C107F	probably damaging	Het
Trim37	T	A	11: 87,140,603		probably null	Het
Ttll5	T	C	12: 86,012,799	V1226A	probably benign	Het
Ube3b	T	C	5: 114,412,870	V865A	probably benign	Het
Vmn2r86	A	T	10: 130,447,097	M550K	probably damaging	Het
Vps54	C	A	11: 21,300,183	T373N	probably benign	Het
Wdr64	T	G	1: 175,805,856	I891S	probably benign	Het
Wisp2	A	G	2: 163,828,984	D137G	probably damaging	Het
Zfhx4	C	T	3: 5,398,859	S1384L	probably damaging	Het
Zfp703	A	G	8: 26,979,085	E259G	possibly damaging	Het
Zfp933	T	C	4: 147,826,512	H209R	probably damaging	Het
Zfp980	A	G	4: 145,702,600	H633R	probably damaging	Het

Other mutations in Abcb5

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00090:Abcb5	APN	12	118890610	missense	probably benign	0.03
IGL00092:Abcb5	APN	12	118928695	missense	probably benign	0.09
IGL00503:Abcb5	APN	12	118907601	missense	probably benign	0.02
IGL00776:Abcb5	APN	12	118919854	missense	probably damaging	1.00
IGL01116:Abcb5	APN	12	118886176	missense	probably benign
IGL01302:Abcb5	APN	12	118918200	missense	probably damaging	1.00
IGL01403:Abcb5	APN	12	118872867	missense	probably damaging	1.00
IGL01453:Abcb5	APN	12	118867970	missense	probably damaging	1.00
IGL01541:Abcb5	APN	12	118911434	missense	probably benign	0.03
IGL01784:Abcb5	APN	12	118890664	missense	probably benign	0.14
IGL01967:Abcb5	APN	12	118867972	missense	probably damaging	1.00
IGL01987:Abcb5	APN	12	118927358	missense	probably damaging	1.00
IGL02104:Abcb5	APN	12	118940680	missense	probably damaging	1.00
IGL02161:Abcb5	APN	12	118874755	missense	probably benign
IGL02292:Abcb5	APN	12	118918197	missense	probably damaging	1.00
IGL02381:Abcb5	APN	12	118940678	missense	probably damaging	1.00
IGL02544:Abcb5	APN	12	118906268	splice site	probably benign
IGL02685:Abcb5	APN	12	118905947	missense	probably damaging	0.99
IGL02824:Abcb5	APN	12	118890685	missense	probably benign	0.05
IGL02876:Abcb5	APN	12	118919841	missense	probably damaging	1.00
IGL02929:Abcb5	APN	12	118944939	missense	probably damaging	0.99
IGL03030:Abcb5	APN	12	118940369	missense	possibly damaging	0.93
IGL03062:Abcb5	APN	12	118936087	missense	probably benign	0.43
IGL03200:Abcb5	APN	12	118965254	splice site	probably benign
IGL03407:Abcb5	APN	12	118940376	missense	probably benign	0.01
alphabet	UTSW	12	118890618	missense	possibly damaging	0.67
google	UTSW	12	118867930	missense	possibly damaging	0.93
F5770:Abcb5	UTSW	12	118886179	missense	probably benign	0.07
PIT4366001:Abcb5	UTSW	12	118936098	missense	probably damaging	1.00
PIT4434001:Abcb5	UTSW	12	118890687	missense	probably damaging	1.00
R0078:Abcb5	UTSW	12	118927394	missense	probably benign
R0219:Abcb5	UTSW	12	118886150	splice site	probably benign
R0312:Abcb5	UTSW	12	118872837	missense	probably damaging	1.00
R0347:Abcb5	UTSW	12	118965251	splice site	probably benign
R0359:Abcb5	UTSW	12	118940332	missense	probably damaging	1.00
R0433:Abcb5	UTSW	12	118877810	missense	probably benign	0.03
R0582:Abcb5	UTSW	12	118940412	missense	probably benign	0.40
R0815:Abcb5	UTSW	12	118901449	splice site	probably benign
R0900:Abcb5	UTSW	12	118940624	missense	probably damaging	1.00
R0942:Abcb5	UTSW	12	118906198	missense	possibly damaging	0.94
R0988:Abcb5	UTSW	12	118932575	missense	probably benign	0.36
R1125:Abcb5	UTSW	12	118911547	missense	possibly damaging	0.87
R1437:Abcb5	UTSW	12	118874762	missense	probably damaging	0.99
R1469:Abcb5	UTSW	12	118867946	missense	possibly damaging	0.83
R1469:Abcb5	UTSW	12	118867946	missense	possibly damaging	0.83
R1678:Abcb5	UTSW	12	118965329	start gained	probably benign
R1726:Abcb5	UTSW	12	118874801	splice site	probably null
R1726:Abcb5	UTSW	12	118907532	missense	possibly damaging	0.95
R1836:Abcb5	UTSW	12	118867961	missense	possibly damaging	0.93
R1934:Abcb5	UTSW	12	118907500	splice site	probably null
R1976:Abcb5	UTSW	12	118890682	missense	probably benign
R2005:Abcb5	UTSW	12	118877827	missense	probably benign	0.15
R2068:Abcb5	UTSW	12	118940568	nonsense	probably null
R2181:Abcb5	UTSW	12	118867946	missense	possibly damaging	0.83
R2191:Abcb5	UTSW	12	118867956	missense	probably damaging	1.00
R3690:Abcb5	UTSW	12	118872933	missense	probably damaging	1.00
R3746:Abcb5	UTSW	12	118874620	missense	probably damaging	0.99
R3825:Abcb5	UTSW	12	118901352	splice site	probably null
R3919:Abcb5	UTSW	12	118890618	missense	possibly damaging	0.67
R4409:Abcb5	UTSW	12	118872922	missense	probably damaging	0.98
R4606:Abcb5	UTSW	12	118932610	critical splice acceptor site	probably null
R4705:Abcb5	UTSW	12	118965305	missense	possibly damaging	0.95
R4954:Abcb5	UTSW	12	118911434	missense	probably benign	0.03
R4966:Abcb5	UTSW	12	118886891	intron	probably benign
R5169:Abcb5	UTSW	12	118877817	nonsense	probably null
R5327:Abcb5	UTSW	12	118911543	missense	probably benign	0.01
R5333:Abcb5	UTSW	12	118867942	missense	probably damaging	1.00
R5366:Abcb5	UTSW	12	118867930	missense	possibly damaging	0.93
R5373:Abcb5	UTSW	12	118887177	missense	probably damaging	1.00
R5399:Abcb5	UTSW	12	118911499	missense	probably benign
R5416:Abcb5	UTSW	12	118907596	missense	probably damaging	1.00
R5447:Abcb5	UTSW	12	118927326	missense	probably damaging	1.00
R5474:Abcb5	UTSW	12	118940690	missense	probably null	1.00
R5566:Abcb5	UTSW	12	118935967	missense	probably damaging	0.99
R5685:Abcb5	UTSW	12	118932613	splice site	probably null
R5691:Abcb5	UTSW	12	118927235	missense	probably damaging	0.99
R5742:Abcb5	UTSW	12	118918257	missense	probably damaging	0.96
R5852:Abcb5	UTSW	12	118927404	missense	probably damaging	0.99
R5917:Abcb5	UTSW	12	118868781	nonsense	probably null
R5994:Abcb5	UTSW	12	118965260	critical splice donor site	probably null
R6295:Abcb5	UTSW	12	118874644	missense	probably damaging	0.99
R6455:Abcb5	UTSW	12	118890549	critical splice donor site	probably null
R6609:Abcb5	UTSW	12	118928762	missense	probably damaging	1.00
R6753:Abcb5	UTSW	12	118944906	missense	possibly damaging	0.86
R6818:Abcb5	UTSW	12	118901354	splice site	probably null
R6870:Abcb5	UTSW	12	118965265	missense	possibly damaging	0.87
R6944:Abcb5	UTSW	12	118911530	missense	probably benign	0.06
R6957:Abcb5	UTSW	12	118907535	missense	probably damaging	1.00
R6984:Abcb5	UTSW	12	118927277	missense	possibly damaging	0.47
R7021:Abcb5	UTSW	12	118931925	missense	probably benign	0.00
R7061:Abcb5	UTSW	12	118877774	missense	probably damaging	1.00
R7175:Abcb5	UTSW	12	118867876	missense	probably benign	0.00
R7239:Abcb5	UTSW	12	118928725	missense	probably benign	0.19
R7267:Abcb5	UTSW	12	118952470	missense	probably damaging	1.00
R7303:Abcb5	UTSW	12	118911560	missense	probably damaging	0.96
R7396:Abcb5	UTSW	12	118867874	missense	probably damaging	1.00
R7605:Abcb5	UTSW	12	118918164	missense	probably damaging	1.00
R7989:Abcb5	UTSW	12	118911543	missense	probably benign	0.01
R8177:Abcb5	UTSW	12	118872790	missense	possibly damaging	0.65
R8296:Abcb5	UTSW	12	118874732	missense	probably benign	0.01
R8544:Abcb5	UTSW	12	118868726	missense	probably damaging	1.00
R8558:Abcb5	UTSW	12	118877831	missense	probably benign	0.07
R8790:Abcb5	UTSW	12	118867885	missense	possibly damaging	0.91
R9003:Abcb5	UTSW	12	118886278	missense	possibly damaging	0.93
R9038:Abcb5	UTSW	12	118931916	missense	probably benign
R9410:Abcb5	UTSW	12	118905968	missense	probably benign	0.00
R9497:Abcb5	UTSW	12	118936115	missense	probably damaging	0.96
R9666:Abcb5	UTSW	12	118874687	missense	probably damaging	0.98
R9682:Abcb5	UTSW	12	118932593	missense	probably damaging	0.99
R9756:Abcb5	UTSW	12	118918138	missense	probably damaging	0.98
V7580:Abcb5	UTSW	12	118886179	missense	probably benign	0.07
Z1176:Abcb5	UTSW	12	118918272	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AAGAACATTTCCCTGGGCTTTTCC -3'
(R):5'- CTCCCACAGTTGCTAATGTGC -3'

Sequencing Primer
(F):5'- CAGATCTTGACTCATTTTGCTCTAAG -3'
(R):5'- CAGTTGCTAATGTGCTTTGTTAACC -3'

Posted On

2015-04-30