Incidental Mutation 'R0388:Tlr6'
ID 31406
Institutional Source Beutler Lab
Gene Symbol Tlr6
Ensembl Gene ENSMUSG00000051498
Gene Name toll-like receptor 6
Synonyms
MMRRC Submission 038594-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.165) question?
Stock # R0388 (G1)
Quality Score 225
Status Validated
Chromosome 5
Chromosomal Location 64952031-64960097 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to T at 64955205 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Histidine to Asparagine at position 120 (H120N)
Ref Sequence ENSEMBL: ENSMUSP00000062096 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000062315] [ENSMUST00000201307]
AlphaFold Q9EPW9
Predicted Effect possibly damaging
Transcript: ENSMUST00000062315
AA Change: H120N

PolyPhen 2 Score 0.736 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000062096
Gene: ENSMUSG00000051498
AA Change: H120N

DomainStartEndE-ValueType
LRR_TYP 86 109 7.67e-2 SMART
LRR 131 155 2.76e1 SMART
LRR 461 482 6.23e1 SMART
LRR 483 507 4.57e0 SMART
LRRCT 540 594 4.06e-11 SMART
transmembrane domain 596 618 N/A INTRINSIC
TIR 652 795 5.37e-37 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000201307
SMART Domains Protein: ENSMUSP00000143865
Gene: ENSMUSG00000051498

DomainStartEndE-ValueType
transmembrane domain 20 39 N/A INTRINSIC
LRR_TYP 86 109 3.3e-4 SMART
Meta Mutation Damage Score 0.1310 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.0%
  • 10x: 95.6%
  • 20x: 90.7%
Validation Efficiency 100% (67/67)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the Toll-like receptor (TLR) family which plays a fundamental role in pathogen recognition and activation of innate immunity. TLRs are highly conserved from Drosophila to humans and share structural and functional similarities. They recognize pathogen-associated molecular patterns (PAMPs) that are expressed on infectious agents, and mediate the production of cytokines necessary for the development of effective immunity. The various TLRs exhibit different patterns of expression. This receptor functionally interacts with toll-like receptor 2 to mediate cellular response to bacterial lipoproteins. A Ser249Pro polymorphism in the extracellular domain of the encoded protein may be associated with an increased of asthma is some populations.[provided by RefSeq, Jan 2011]
PHENOTYPE: Inactivation of this gene results in abnormal macrophage function. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010315B03Rik T C 9: 124,295,159 probably benign Het
Acsbg1 T C 9: 54,609,063 K678R probably damaging Het
Adgrg6 A G 10: 14,450,658 I410T probably benign Het
Afap1l2 A C 19: 56,917,242 probably benign Het
Aox2 T C 1: 58,354,406 Y1242H probably damaging Het
Apoo-ps T C 13: 107,414,673 noncoding transcript Het
Camta1 C A 4: 151,075,140 R1614L probably damaging Het
Cdh3 C A 8: 106,539,129 T268K probably damaging Het
Chd5 T A 4: 152,371,644 H923Q probably damaging Het
Chd7 T C 4: 8,854,560 V1967A probably benign Het
Cntn3 T C 6: 102,277,316 M222V probably damaging Het
Dcaf17 A G 2: 71,078,571 K277R probably benign Het
Dmbt1 T C 7: 131,096,049 probably benign Het
Dmpk T A 7: 19,084,077 probably benign Het
Dzank1 A T 2: 144,476,106 L714Q possibly damaging Het
Efcab3 A G 11: 105,109,401 D272G possibly damaging Het
Erbb2 G C 11: 98,427,351 R471P possibly damaging Het
Esf1 T A 2: 140,120,871 Y760F possibly damaging Het
Fanci C A 7: 79,439,630 T938K probably benign Het
Gnai3 A G 3: 108,115,757 probably benign Het
Hspg2 T A 4: 137,511,158 C319S probably damaging Het
Il12a T A 3: 68,695,187 probably null Het
Inpp4a A G 1: 37,396,160 D837G probably damaging Het
Kcnj5 T A 9: 32,317,863 E13V probably damaging Het
Kcnq3 T A 15: 66,000,038 Y594F probably benign Het
Kif16b T C 2: 142,740,937 E556G probably damaging Het
Kif28 T C 1: 179,740,089 I39V possibly damaging Het
Lgi2 T C 5: 52,554,549 E143G probably damaging Het
Mast1 T G 8: 84,915,537 I1063L probably benign Het
Med12l T C 3: 59,093,504 probably benign Het
Mmp19 G T 10: 128,798,883 R456L probably benign Het
Mon1b T A 8: 113,639,078 V346E probably damaging Het
Mpv17l A T 16: 13,940,999 I96L probably benign Het
Mrgpra9 A T 7: 47,252,794 M1K probably null Het
Mycbp2 A T 14: 103,156,667 H2819Q probably benign Het
Nav1 A C 1: 135,448,917 probably benign Het
Neurl4 T C 11: 69,911,733 probably benign Het
Ntng2 G C 2: 29,207,426 P341R probably damaging Het
Oas1d A T 5: 120,917,028 Y221F probably damaging Het
Olfr1040 A G 2: 86,146,630 Y35H probably damaging Het
Olfr348 C A 2: 36,786,862 D112E probably benign Het
Olfr365 A C 2: 37,202,184 probably null Het
Osbpl8 A G 10: 111,272,282 M380V probably benign Het
Pank1 T C 19: 34,821,706 probably benign Het
Parn T C 16: 13,654,476 D169G possibly damaging Het
Pknox1 T A 17: 31,603,192 I311N probably damaging Het
Pprc1 T C 19: 46,062,775 V248A possibly damaging Het
Prkcq T C 2: 11,254,234 C322R probably benign Het
Ptpn13 T A 5: 103,555,062 I1298N probably benign Het
Rab11fip3 A G 17: 26,069,072 S36P probably benign Het
Rif1 GCCACCA GCCA 2: 52,110,324 probably benign Het
Sass6 C A 3: 116,607,308 probably benign Het
Shroom3 G A 5: 92,951,293 G1463D probably benign Het
Slc35d1 A T 4: 103,184,887 Y249* probably null Het
Slc9a3 C T 13: 74,121,536 P8S unknown Het
Slc9a9 T A 9: 94,939,563 probably null Het
Syne2 T A 12: 75,986,975 M3666K probably benign Het
Synpo2 A G 3: 123,079,897 V1140A probably benign Het
Thada A G 17: 84,231,096 F1495L probably benign Het
Timeless A G 10: 128,241,425 probably null Het
Tmem173 A G 18: 35,735,111 probably null Het
Tns3 T C 11: 8,445,703 I1234V probably benign Het
Ttll9 A G 2: 153,000,179 S318G probably benign Het
Vps13c T C 9: 67,922,915 probably benign Het
Zfp933 T C 4: 147,826,442 I232M probably benign Het
Zfyve27 T C 19: 42,189,585 S382P probably damaging Het
Other mutations in Tlr6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00949:Tlr6 APN 5 64953512 missense probably damaging 1.00
IGL00963:Tlr6 APN 5 64954676 missense possibly damaging 0.89
IGL01540:Tlr6 APN 5 64955286 missense probably damaging 0.97
IGL01675:Tlr6 APN 5 64954499 missense probably damaging 1.00
IGL01705:Tlr6 APN 5 64954130 missense probably benign 0.03
IGL02256:Tlr6 APN 5 64954944 missense probably benign 0.00
Counterintuitive UTSW 5 64953595 missense probably damaging 1.00
insouciant UTSW 5 64954583 missense possibly damaging 0.81
m2sd1 UTSW 5 64954194 nonsense
m2sd2 UTSW 5 64954394 nonsense
m2sd3 UTSW 5 64954241 missense probably damaging 0.98
One_off UTSW 5 64953251 missense probably damaging 1.00
R0336:Tlr6 UTSW 5 64953946 missense probably benign 0.02
R0558:Tlr6 UTSW 5 64954860 nonsense probably null
R0671:Tlr6 UTSW 5 64954592 missense probably benign 0.00
R1171:Tlr6 UTSW 5 64955250 missense probably benign 0.00
R1550:Tlr6 UTSW 5 64953411 missense probably damaging 0.98
R1809:Tlr6 UTSW 5 64953712 nonsense probably null
R1868:Tlr6 UTSW 5 64954829 missense probably benign 0.00
R1876:Tlr6 UTSW 5 64955420 missense probably damaging 1.00
R1893:Tlr6 UTSW 5 64953213 missense probably damaging 1.00
R2006:Tlr6 UTSW 5 64953405 missense probably damaging 1.00
R2055:Tlr6 UTSW 5 64953926 missense probably damaging 1.00
R3087:Tlr6 UTSW 5 64954325 missense probably damaging 1.00
R3406:Tlr6 UTSW 5 64953429 missense probably damaging 1.00
R3711:Tlr6 UTSW 5 64953809 missense possibly damaging 0.75
R3938:Tlr6 UTSW 5 64953595 missense probably damaging 1.00
R3962:Tlr6 UTSW 5 64954985 missense probably benign 0.10
R4152:Tlr6 UTSW 5 64953212 missense probably damaging 1.00
R4274:Tlr6 UTSW 5 64953638 missense probably benign 0.01
R4516:Tlr6 UTSW 5 64954904 missense possibly damaging 0.67
R4518:Tlr6 UTSW 5 64954904 missense possibly damaging 0.67
R4762:Tlr6 UTSW 5 64954396 missense probably benign 0.09
R4959:Tlr6 UTSW 5 64953659 missense possibly damaging 0.81
R5119:Tlr6 UTSW 5 64954301 missense probably benign 0.06
R5248:Tlr6 UTSW 5 64955304 missense probably benign 0.30
R5507:Tlr6 UTSW 5 64953406 missense probably damaging 1.00
R5572:Tlr6 UTSW 5 64955018 missense probably damaging 1.00
R5773:Tlr6 UTSW 5 64954503 missense probably benign 0.00
R6711:Tlr6 UTSW 5 64954492 missense probably damaging 1.00
R7096:Tlr6 UTSW 5 64953776 missense probably benign
R7341:Tlr6 UTSW 5 64953629 missense probably benign 0.32
R7594:Tlr6 UTSW 5 64953251 missense probably damaging 1.00
R7754:Tlr6 UTSW 5 64954350 missense possibly damaging 0.64
R7774:Tlr6 UTSW 5 64953385 missense probably damaging 0.99
R8292:Tlr6 UTSW 5 64953791 missense probably damaging 1.00
R8348:Tlr6 UTSW 5 64953842 missense probably damaging 1.00
R8376:Tlr6 UTSW 5 64955112 missense probably benign 0.00
R8448:Tlr6 UTSW 5 64953842 missense probably damaging 1.00
R9620:Tlr6 UTSW 5 64954803 missense possibly damaging 0.68
R9654:Tlr6 UTSW 5 64955354 missense probably damaging 1.00
Z1177:Tlr6 UTSW 5 64955239 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- CAGTTGTCGGAACTTTGCAGCAC -3'
(R):5'- GCCTTAATAGTCGGAAGCATGACCC -3'

Sequencing Primer
(F):5'- CGGAACTTTGCAGCACTTAATC -3'
(R):5'- AAGCATGACCCCGTTCTCTAATG -3'
Posted On 2013-04-24