Mutagenetix > Incidental Mutation

Incidental Mutation 'R0388:Shroom3'

31407

Institutional Source

Beutler Lab

Gene Symbol

Shroom3

Ensembl Gene

ENSMUSG00000029381

Gene Name

shroom family member 3

Synonyms

D5Ertd287e, Shrm3, Shrm

MMRRC Submission

038594-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R0388 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

92683435-92965318 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 92951293 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glycine to Aspartic acid at position 1463 (G1463D)

Ref Sequence

ENSEMBL: ENSMUSP00000153516 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000113051] [ENSMUST00000113054] [ENSMUST00000113055] [ENSMUST00000168878] [ENSMUST00000225438]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000113051
AA Change: G1369D

PolyPhen 2 Score 0.225 (Sensitivity: 0.91; Specificity: 0.88)

SMART Domains

Protein: ENSMUSP00000108674
Gene: ENSMUSG00000029381
AA Change: G1369D

Domain	Start	End	E-Value	Type
low complexity region	16	27	N/A	INTRINSIC
low complexity region	83	93	N/A	INTRINSIC
low complexity region	572	586	N/A	INTRINSIC
low complexity region	621	639	N/A	INTRINSIC
low complexity region	685	704	N/A	INTRINSIC
Pfam:ASD1	706	885	2.3e-65	PFAM
low complexity region	939	952	N/A	INTRINSIC
low complexity region	1132	1143	N/A	INTRINSIC
low complexity region	1172	1184	N/A	INTRINSIC
low complexity region	1274	1288	N/A	INTRINSIC
low complexity region	1333	1345	N/A	INTRINSIC
Pfam:ASD2	1478	1765	3.1e-107	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000113054
AA Change: G1369D

PolyPhen 2 Score 0.225 (Sensitivity: 0.91; Specificity: 0.88)

SMART Domains

Protein: ENSMUSP00000108677
Gene: ENSMUSG00000029381
AA Change: G1369D

Domain	Start	End	E-Value	Type
low complexity region	16	27	N/A	INTRINSIC
low complexity region	83	93	N/A	INTRINSIC
low complexity region	572	586	N/A	INTRINSIC
low complexity region	621	639	N/A	INTRINSIC
low complexity region	685	704	N/A	INTRINSIC
Pfam:ASD1	706	885	2.3e-65	PFAM
low complexity region	939	952	N/A	INTRINSIC
low complexity region	1132	1143	N/A	INTRINSIC
low complexity region	1172	1184	N/A	INTRINSIC
low complexity region	1274	1288	N/A	INTRINSIC
low complexity region	1333	1345	N/A	INTRINSIC
Pfam:ASD2	1478	1765	3.1e-107	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000113055
AA Change: G1544D

PolyPhen 2 Score 0.270 (Sensitivity: 0.91; Specificity: 0.88)

SMART Domains

Protein: ENSMUSP00000108678
Gene: ENSMUSG00000029381
AA Change: G1544D

Domain	Start	End	E-Value	Type
PDZ	35	109	5.81e-11	SMART
low complexity region	191	202	N/A	INTRINSIC
low complexity region	258	268	N/A	INTRINSIC
low complexity region	747	761	N/A	INTRINSIC
low complexity region	796	814	N/A	INTRINSIC
low complexity region	860	879	N/A	INTRINSIC
Pfam:ASD1	882	1060	1e-57	PFAM
low complexity region	1114	1127	N/A	INTRINSIC
low complexity region	1307	1318	N/A	INTRINSIC
low complexity region	1347	1359	N/A	INTRINSIC
low complexity region	1449	1463	N/A	INTRINSIC
low complexity region	1508	1520	N/A	INTRINSIC
Pfam:ASD2	1654	1940	9.9e-112	PFAM

Predicted Effect

unknown
Transcript: ENSMUST00000168878
AA Change: G1413D

SMART Domains

Protein: ENSMUSP00000130419
Gene: ENSMUSG00000029381
AA Change: G1413D

Domain	Start	End	E-Value	Type
PDZ	35	109	5.81e-11	SMART
low complexity region	191	202	N/A	INTRINSIC
low complexity region	258	268	N/A	INTRINSIC
low complexity region	747	761	N/A	INTRINSIC
low complexity region	796	814	N/A	INTRINSIC
low complexity region	860	879	N/A	INTRINSIC
low complexity region	983	996	N/A	INTRINSIC
low complexity region	1176	1187	N/A	INTRINSIC
low complexity region	1216	1228	N/A	INTRINSIC
low complexity region	1318	1332	N/A	INTRINSIC
low complexity region	1377	1389	N/A	INTRINSIC
Pfam:ASD2	1522	1809	8.9e-108	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000200869

Predicted Effect

probably benign
Transcript: ENSMUST00000225438
AA Change: G1463D

PolyPhen 2 Score 0.390 (Sensitivity: 0.90; Specificity: 0.89)

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.0%
3x: 98.0%
10x: 95.6%
20x: 90.7%

Validation Efficiency

100% (67/67)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a PDZ-domain-containing protein that belongs to a family of Shroom-related proteins. This protein may be involved in regulating cell shape in certain tissues. A similar protein in mice is required for proper neurulation. [provided by RefSeq, Jan 2011]
PHENOTYPE: Homozygous mutation of this locus results in failed neural tube closure leading to exencephaly, acrania, facial clefting, and spina bifida. Homozygotes develop to term but die either at birth or shortly thereafter. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 66 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2010315B03Rik	T	C	9: 124,295,159		probably benign	Het
Acsbg1	T	C	9: 54,609,063	K678R	probably damaging	Het
Adgrg6	A	G	10: 14,450,658	I410T	probably benign	Het
Afap1l2	A	C	19: 56,917,242		probably benign	Het
Aox2	T	C	1: 58,354,406	Y1242H	probably damaging	Het
Apoo-ps	T	C	13: 107,414,673		noncoding transcript	Het
Camta1	C	A	4: 151,075,140	R1614L	probably damaging	Het
Cdh3	C	A	8: 106,539,129	T268K	probably damaging	Het
Chd5	T	A	4: 152,371,644	H923Q	probably damaging	Het
Chd7	T	C	4: 8,854,560	V1967A	probably benign	Het
Cntn3	T	C	6: 102,277,316	M222V	probably damaging	Het
Dcaf17	A	G	2: 71,078,571	K277R	probably benign	Het
Dmbt1	T	C	7: 131,096,049		probably benign	Het
Dmpk	T	A	7: 19,084,077		probably benign	Het
Dzank1	A	T	2: 144,476,106	L714Q	possibly damaging	Het
Efcab3	A	G	11: 105,109,401	D272G	possibly damaging	Het
Erbb2	G	C	11: 98,427,351	R471P	possibly damaging	Het
Esf1	T	A	2: 140,120,871	Y760F	possibly damaging	Het
Fanci	C	A	7: 79,439,630	T938K	probably benign	Het
Gnai3	A	G	3: 108,115,757		probably benign	Het
Hspg2	T	A	4: 137,511,158	C319S	probably damaging	Het
Il12a	T	A	3: 68,695,187		probably null	Het
Inpp4a	A	G	1: 37,396,160	D837G	probably damaging	Het
Kcnj5	T	A	9: 32,317,863	E13V	probably damaging	Het
Kcnq3	T	A	15: 66,000,038	Y594F	probably benign	Het
Kif16b	T	C	2: 142,740,937	E556G	probably damaging	Het
Kif28	T	C	1: 179,740,089	I39V	possibly damaging	Het
Lgi2	T	C	5: 52,554,549	E143G	probably damaging	Het
Mast1	T	G	8: 84,915,537	I1063L	probably benign	Het
Med12l	T	C	3: 59,093,504		probably benign	Het
Mmp19	G	T	10: 128,798,883	R456L	probably benign	Het
Mon1b	T	A	8: 113,639,078	V346E	probably damaging	Het
Mpv17l	A	T	16: 13,940,999	I96L	probably benign	Het
Mrgpra9	A	T	7: 47,252,794	M1K	probably null	Het
Mycbp2	A	T	14: 103,156,667	H2819Q	probably benign	Het
Nav1	A	C	1: 135,448,917		probably benign	Het
Neurl4	T	C	11: 69,911,733		probably benign	Het
Ntng2	G	C	2: 29,207,426	P341R	probably damaging	Het
Oas1d	A	T	5: 120,917,028	Y221F	probably damaging	Het
Olfr1040	A	G	2: 86,146,630	Y35H	probably damaging	Het
Olfr348	C	A	2: 36,786,862	D112E	probably benign	Het
Olfr365	A	C	2: 37,202,184		probably null	Het
Osbpl8	A	G	10: 111,272,282	M380V	probably benign	Het
Pank1	T	C	19: 34,821,706		probably benign	Het
Parn	T	C	16: 13,654,476	D169G	possibly damaging	Het
Pknox1	T	A	17: 31,603,192	I311N	probably damaging	Het
Pprc1	T	C	19: 46,062,775	V248A	possibly damaging	Het
Prkcq	T	C	2: 11,254,234	C322R	probably benign	Het
Ptpn13	T	A	5: 103,555,062	I1298N	probably benign	Het
Rab11fip3	A	G	17: 26,069,072	S36P	probably benign	Het
Rif1	GCCACCA	GCCA	2: 52,110,324		probably benign	Het
Sass6	C	A	3: 116,607,308		probably benign	Het
Slc35d1	A	T	4: 103,184,887	Y249*	probably null	Het
Slc9a3	C	T	13: 74,121,536	P8S	unknown	Het
Slc9a9	T	A	9: 94,939,563		probably null	Het
Syne2	T	A	12: 75,986,975	M3666K	probably benign	Het
Synpo2	A	G	3: 123,079,897	V1140A	probably benign	Het
Thada	A	G	17: 84,231,096	F1495L	probably benign	Het
Timeless	A	G	10: 128,241,425		probably null	Het
Tlr6	G	T	5: 64,955,205	H120N	possibly damaging	Het
Tmem173	A	G	18: 35,735,111		probably null	Het
Tns3	T	C	11: 8,445,703	I1234V	probably benign	Het
Ttll9	A	G	2: 153,000,179	S318G	probably benign	Het
Vps13c	T	C	9: 67,922,915		probably benign	Het
Zfp933	T	C	4: 147,826,442	I232M	probably benign	Het
Zfyve27	T	C	19: 42,189,585	S382P	probably damaging	Het

Other mutations in Shroom3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00850:Shroom3	APN	5	92951065	missense	probably damaging	1.00
IGL01086:Shroom3	APN	5	92948452	missense	probably benign	0.01
IGL01363:Shroom3	APN	5	92940993	missense	probably benign	0.01
IGL01468:Shroom3	APN	5	92940342	missense	probably damaging	1.00
IGL01675:Shroom3	APN	5	92941680	missense	probably damaging	0.99
IGL01862:Shroom3	APN	5	92962289	missense	probably damaging	1.00
IGL01987:Shroom3	APN	5	92942189	missense	probably damaging	0.99
IGL02104:Shroom3	APN	5	92940389	missense	probably benign	0.32
IGL03248:Shroom3	APN	5	92952540	missense	probably benign	0.00
IGL03386:Shroom3	APN	5	92948483	splice site	probably benign
R0167:Shroom3	UTSW	5	92948395	splice site	probably benign
R0395:Shroom3	UTSW	5	92780903	missense	probably damaging	1.00
R0567:Shroom3	UTSW	5	92964453	missense	possibly damaging	0.53
R1496:Shroom3	UTSW	5	92942834	missense	possibly damaging	0.69
R1772:Shroom3	UTSW	5	92940656	missense	probably damaging	0.97
R1845:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R1921:Shroom3	UTSW	5	92962365	critical splice donor site	probably null
R2059:Shroom3	UTSW	5	92683784	missense	probably damaging	1.00
R2203:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R2204:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R2205:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R2301:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R2344:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R2345:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R2346:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R2348:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R2371:Shroom3	UTSW	5	92780870	missense	probably damaging	1.00
R2435:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R2829:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R2830:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R2831:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R2897:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R2898:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R3079:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R3080:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R3433:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R3729:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R3730:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R3735:Shroom3	UTSW	5	92964444	missense	possibly damaging	0.84
R3736:Shroom3	UTSW	5	92964444	missense	possibly damaging	0.84
R3851:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R3852:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R3943:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R3969:Shroom3	UTSW	5	92940879	missense	probably benign	0.05
R4008:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R4009:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R4012:Shroom3	UTSW	5	92948483	splice site	probably benign
R4154:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R4157:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R4172:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R4173:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R4201:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R4202:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R4204:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R4205:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R4206:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R4284:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R4285:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R4364:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R4384:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R4456:Shroom3	UTSW	5	92940999	missense	probably benign	0.14
R4707:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R4712:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R4751:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R4755:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R4760:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R4773:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R4774:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R4776:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R4801:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R4802:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R4856:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R4857:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R4860:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R4860:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R4882:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R4883:Shroom3	UTSW	5	92951134	missense	probably benign	0.14
R4886:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R5262:Shroom3	UTSW	5	92964573	missense	probably damaging	1.00
R5271:Shroom3	UTSW	5	92962248	missense	probably damaging	1.00
R5719:Shroom3	UTSW	5	92943018	missense	probably benign	0.04
R5726:Shroom3	UTSW	5	92943005	missense	probably benign	0.00
R5993:Shroom3	UTSW	5	92940188	missense	probably damaging	1.00
R6078:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R6079:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R6138:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R6153:Shroom3	UTSW	5	92964408	missense	probably damaging	0.99
R6493:Shroom3	UTSW	5	92941561	missense	probably benign	0.03
R6495:Shroom3	UTSW	5	92942069	missense	possibly damaging	0.66
R6693:Shroom3	UTSW	5	92940758	missense	possibly damaging	0.61
R6801:Shroom3	UTSW	5	92940936	missense	probably damaging	1.00
R6893:Shroom3	UTSW	5	92942204	missense	probably damaging	0.97
R6912:Shroom3	UTSW	5	92943017	missense	probably benign	0.02
R6924:Shroom3	UTSW	5	92964403	missense	probably damaging	1.00
R7083:Shroom3	UTSW	5	92964525	missense	probably damaging	1.00
R7197:Shroom3	UTSW	5	92942604	missense	probably damaging	1.00
R7366:Shroom3	UTSW	5	92964606	nonsense	probably null
R7712:Shroom3	UTSW	5	92950947	missense	probably benign	0.01
R7725:Shroom3	UTSW	5	92941653	missense	probably benign	0.19
R7728:Shroom3	UTSW	5	92683707	missense	possibly damaging	0.73
R7774:Shroom3	UTSW	5	92950489	missense	probably damaging	0.98
R7795:Shroom3	UTSW	5	92919649	missense	probably damaging	0.99
R7821:Shroom3	UTSW	5	92940846	missense	probably damaging	0.98
R7971:Shroom3	UTSW	5	92951074	missense	probably damaging	1.00
R8276:Shroom3	UTSW	5	92940480	missense	probably damaging	0.99
R8934:Shroom3	UTSW	5	92941725	missense	probably damaging	1.00
R8938:Shroom3	UTSW	5	92943071	missense	probably damaging	1.00
R9083:Shroom3	UTSW	5	92950674	missense	probably damaging	0.97
R9108:Shroom3	UTSW	5	92940116	missense	probably damaging	1.00
R9124:Shroom3	UTSW	5	92964542	missense	probably benign	0.19
R9295:Shroom3	UTSW	5	92950619	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- CGAATATCGGAGTCAGCCCTTCAAC -3'
(R):5'- CAGACAAGAGGAACTGCGTCTTGG -3'

Sequencing Primer
(F):5'- CCGGGGGGACTATGATGAC -3'
(R):5'- GCGTCTTGGCTCTTCAAATC -3'

Posted On

2013-04-24