Incidental Mutation 'R4049:Spire1'
ID314074
Institutional Source Beutler Lab
Gene Symbol Spire1
Ensembl Gene ENSMUSG00000024533
Gene Namespire type actin nucleation factor 1
Synonyms6030430B19Rik, Spir-1
MMRRC Submission 041616-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.234) question?
Stock #R4049 (G1)
Quality Score225
Status Validated
Chromosome18
Chromosomal Location67488209-67610790 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) G to T at 67529031 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000153492 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045105] [ENSMUST00000082243] [ENSMUST00000115050] [ENSMUST00000224799]
Predicted Effect probably null
Transcript: ENSMUST00000045105
SMART Domains Protein: ENSMUSP00000049336
Gene: ENSMUSG00000024533

DomainStartEndE-ValueType
Pfam:KIND 1 78 3.3e-27 PFAM
PDB:4EFH|B 176 232 9e-6 PDB
low complexity region 289 316 N/A INTRINSIC
low complexity region 339 350 N/A INTRINSIC
SCOP:d1zbdb_ 445 518 1e-7 SMART
low complexity region 596 606 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000082243
SMART Domains Protein: ENSMUSP00000080871
Gene: ENSMUSG00000024533

DomainStartEndE-ValueType
Blast:KIND 1 73 2e-26 BLAST
PDB:3RBW|D 1 79 3e-28 PDB
PDB:4EFH|B 176 232 9e-6 PDB
low complexity region 302 329 N/A INTRINSIC
low complexity region 352 363 N/A INTRINSIC
SCOP:d1zbdb_ 400 473 2e-7 SMART
low complexity region 551 561 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000115050
SMART Domains Protein: ENSMUSP00000110702
Gene: ENSMUSG00000024533

DomainStartEndE-ValueType
PDB:4EFH|B 106 162 9e-6 PDB
low complexity region 219 246 N/A INTRINSIC
low complexity region 269 280 N/A INTRINSIC
SCOP:d1zbdb_ 317 390 4e-7 SMART
low complexity region 468 478 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000224799
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.6%
Validation Efficiency 100% (65/65)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Spire proteins, such as SPIRE1, are highly conserved between species. They belong to the family of Wiskott-Aldrich homology region-2 (WH2) proteins, which are involved in actin organization (Kerkhoff et al., 2001 [PubMed 11747823]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Mice homozygous for a knock-out allele are viable and fertile with normal brain anatomy and intact visual and motor functions in both sexes, but show a male-specific increase in contextual and cued fear memory. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb5 T A 12: 118,868,669 E1190V probably damaging Het
Arhgef10 A G 8: 14,979,998 T928A probably benign Het
Arhgef10l T A 4: 140,515,451 I836F probably benign Het
Blm T A 7: 80,502,862 T446S probably benign Het
Ccdc63 T A 5: 122,122,750 Q237L probably damaging Het
Cep57l1 G T 10: 41,729,360 R130S probably damaging Het
Clstn2 T G 9: 97,457,560 E786A possibly damaging Het
Col16a1 C T 4: 130,068,752 P540L probably damaging Het
Csf2 A G 11: 54,249,333 F61L probably damaging Het
Ctr9 C T 7: 111,055,543 R1094C unknown Het
Cyp3a41a A G 5: 145,713,540 C98R probably damaging Het
Dthd1 T A 5: 62,827,165 C404* probably null Het
Egfem1 A C 3: 29,686,731 H518P probably benign Het
Elf3 T C 1: 135,254,277 S369G probably benign Het
Eml6 C T 11: 29,838,577 V503M probably damaging Het
Enthd1 T C 15: 80,560,039 D105G probably damaging Het
Eral1 A G 11: 78,075,602 L250P probably damaging Het
Gdf15 A T 8: 70,629,955 M167K probably benign Het
Ggps1 T C 13: 14,053,699 K300E probably benign Het
Gm8074 G A 9: 78,322,336 noncoding transcript Het
Herc3 A G 6: 58,876,837 I623V probably damaging Het
Mad1l1 A G 5: 140,132,816 S457P probably damaging Het
Map1lc3a G T 2: 155,277,542 V91F possibly damaging Het
Map4k3 A G 17: 80,605,965 V617A probably benign Het
Mov10l1 T A 15: 88,995,032 probably benign Het
Mroh2a A G 1: 88,258,664 S64G probably benign Het
Ncor1 G T 11: 62,329,668 probably null Het
Nfe2 C T 15: 103,250,937 E36K possibly damaging Het
Olfr1176 T C 2: 88,343,800 probably null Het
Olfr1212 A G 2: 88,959,273 K269R probably benign Het
Olfr1251 T C 2: 89,667,662 I75V probably benign Het
Olfr653 T C 7: 104,580,368 F241L probably benign Het
Oprm1 G A 10: 6,829,087 V95I probably benign Het
Pcdha9 T A 18: 36,997,942 H21Q probably benign Het
Pcolce2 A T 9: 95,638,755 I62F probably damaging Het
Pfpl T A 19: 12,429,689 C435S probably damaging Het
Pkhd1l1 G A 15: 44,498,557 C542Y probably damaging Het
Plekha5 T C 6: 140,583,871 S75P probably damaging Het
Pphln1 C A 15: 93,465,106 A202E probably damaging Het
Ppp1r1a A G 15: 103,532,454 L92P probably damaging Het
Prokr2 T C 2: 132,381,494 T43A probably benign Het
Rai14 T C 15: 10,592,212 N199S probably benign Het
Rasgrp2 T C 19: 6,404,727 L199P probably damaging Het
Rnf213 A C 11: 119,482,448 M4939L possibly damaging Het
Slc23a2 C T 2: 132,060,683 R533Q probably benign Het
Slc7a7 T C 14: 54,373,091 probably null Het
Snrpd2 T A 7: 19,151,307 V31E probably damaging Het
Srsf4 T C 4: 131,900,543 probably benign Het
Tcf20 A G 15: 82,853,429 S1274P probably damaging Het
Tcof1 C A 18: 60,832,903 A376S possibly damaging Het
Thsd1 T A 8: 22,243,164 Y76N possibly damaging Het
Timm44 A G 8: 4,260,561 V397A probably benign Het
Tmc6 G A 11: 117,778,261 T89I possibly damaging Het
Trbv31 C A 6: 41,557,705 C107F probably damaging Het
Trim37 T A 11: 87,140,603 probably null Het
Ttll5 T C 12: 86,012,799 V1226A probably benign Het
Ube3b T C 5: 114,412,870 V865A probably benign Het
Vmn2r86 A T 10: 130,447,097 M550K probably damaging Het
Vps54 C A 11: 21,300,183 T373N probably benign Het
Wdr64 T G 1: 175,805,856 I891S probably benign Het
Wisp2 A G 2: 163,828,984 D137G probably damaging Het
Zfhx4 C T 3: 5,398,859 S1384L probably damaging Het
Zfp703 A G 8: 26,979,085 E259G possibly damaging Het
Zfp933 T C 4: 147,826,512 H209R probably damaging Het
Zfp980 A G 4: 145,702,600 H633R probably damaging Het
Other mutations in Spire1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00423:Spire1 APN 18 67529015 missense probably damaging 1.00
IGL01639:Spire1 APN 18 67545668 missense possibly damaging 0.74
IGL02334:Spire1 APN 18 67506655 missense probably benign 0.00
PIT4677001:Spire1 UTSW 18 67491365 missense probably damaging 1.00
R0457:Spire1 UTSW 18 67552600 missense probably damaging 0.98
R0531:Spire1 UTSW 18 67491305 missense probably damaging 1.00
R0608:Spire1 UTSW 18 67528875 missense probably damaging 0.99
R2098:Spire1 UTSW 18 67503466 missense probably damaging 0.99
R2299:Spire1 UTSW 18 67530423 missense probably damaging 1.00
R3028:Spire1 UTSW 18 67491347 missense probably damaging 1.00
R3815:Spire1 UTSW 18 67506663 missense probably benign 0.05
R4050:Spire1 UTSW 18 67529031 splice site probably null
R4059:Spire1 UTSW 18 67545713 missense probably damaging 0.98
R4109:Spire1 UTSW 18 67497217 missense probably damaging 1.00
R4700:Spire1 UTSW 18 67512865 missense probably benign 0.01
R4941:Spire1 UTSW 18 67519314 missense possibly damaging 0.54
R4995:Spire1 UTSW 18 67552779 splice site probably null
R5363:Spire1 UTSW 18 67506555 missense probably damaging 1.00
R5561:Spire1 UTSW 18 67506646 missense probably damaging 0.96
R5795:Spire1 UTSW 18 67495195 missense probably benign
R5952:Spire1 UTSW 18 67506709 missense probably benign 0.00
R5982:Spire1 UTSW 18 67497316 critical splice acceptor site probably null
R7388:Spire1 UTSW 18 67519880 missense probably damaging 1.00
R7559:Spire1 UTSW 18 67501117 missense probably benign 0.04
R8006:Spire1 UTSW 18 67501181 nonsense probably null
R8111:Spire1 UTSW 18 67519321 missense probably damaging 0.98
R8675:Spire1 UTSW 18 67491308 missense possibly damaging 0.48
T0970:Spire1 UTSW 18 67501063 splice site probably null
Z1088:Spire1 UTSW 18 67495152 missense possibly damaging 0.89
Predicted Primers PCR Primer
(F):5'- CAGCCATCTGAGTGCTTACC -3'
(R):5'- TTCAGTAAGCAGATTCTCACAGTAG -3'

Sequencing Primer
(F):5'- AGCCATCTGAGTGCTTACCATTAC -3'
(R):5'- TAGGGGTATGCCTTTTAAGCAGCC -3'
Posted On2015-04-30