Incidental Mutation 'R4049:Rasgrp2'
ID314075
Institutional Source Beutler Lab
Gene Symbol Rasgrp2
Ensembl Gene ENSMUSG00000032946
Gene NameRAS, guanyl releasing protein 2
SynonymsCaldaggef1, CalDAG-GEFI
MMRRC Submission 041616-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4049 (G1)
Quality Score225
Status Validated
Chromosome19
Chromosomal Location6399340-6415216 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 6404727 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 199 (L199P)
Ref Sequence ENSEMBL: ENSMUSP00000129873 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035716] [ENSMUST00000113467] [ENSMUST00000113468] [ENSMUST00000113469] [ENSMUST00000113471] [ENSMUST00000113472] [ENSMUST00000113475] [ENSMUST00000113476] [ENSMUST00000127021] [ENSMUST00000138555] [ENSMUST00000139522] [ENSMUST00000146601] [ENSMUST00000146831] [ENSMUST00000150713] [ENSMUST00000167240]
Predicted Effect probably damaging
Transcript: ENSMUST00000035716
AA Change: L199P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000041135
Gene: ENSMUSG00000032946
AA Change: L199P

DomainStartEndE-ValueType
RasGEFN 3 126 3.56e-29 SMART
RasGEF 150 388 1.08e-100 SMART
EFh 430 458 8.25e-3 SMART
EFh 459 487 1.42e1 SMART
C1 499 548 3.22e-14 SMART
low complexity region 575 595 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000113467
SMART Domains Protein: ENSMUSP00000109095
Gene: ENSMUSG00000032946

DomainStartEndE-ValueType
Blast:RasGEFN 3 24 9e-8 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000113468
SMART Domains Protein: ENSMUSP00000109096
Gene: ENSMUSG00000032946

DomainStartEndE-ValueType
RasGEFN 3 97 1.93e-7 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000113469
SMART Domains Protein: ENSMUSP00000109097
Gene: ENSMUSG00000032946

DomainStartEndE-ValueType
Blast:RasGEFN 3 24 1e-7 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000113471
SMART Domains Protein: ENSMUSP00000109099
Gene: ENSMUSG00000032946

DomainStartEndE-ValueType
RasGEFN 3 126 7.2e-31 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000113472
SMART Domains Protein: ENSMUSP00000109100
Gene: ENSMUSG00000032946

DomainStartEndE-ValueType
RasGEFN 3 126 7.2e-31 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000113475
SMART Domains Protein: ENSMUSP00000109103
Gene: ENSMUSG00000032946

DomainStartEndE-ValueType
RasGEFN 3 126 7.2e-31 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000113476
AA Change: L199P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000109104
Gene: ENSMUSG00000032946
AA Change: L199P

DomainStartEndE-ValueType
RasGEFN 3 126 3.56e-29 SMART
RasGEF 150 388 1.08e-100 SMART
EFh 430 458 8.25e-3 SMART
EFh 459 487 1.42e1 SMART
C1 499 548 3.22e-14 SMART
low complexity region 575 595 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000122930
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123661
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124118
Predicted Effect probably benign
Transcript: ENSMUST00000127021
SMART Domains Protein: ENSMUSP00000119740
Gene: ENSMUSG00000032946

DomainStartEndE-ValueType
Blast:RasGEFN 3 24 1e-7 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130480
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133968
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135532
Predicted Effect probably damaging
Transcript: ENSMUST00000138555
AA Change: L199P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000121635
Gene: ENSMUSG00000032946
AA Change: L199P

DomainStartEndE-ValueType
RasGEFN 3 126 3.56e-29 SMART
Pfam:RasGEF 151 231 1.6e-15 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000139522
SMART Domains Protein: ENSMUSP00000123036
Gene: ENSMUSG00000032946

DomainStartEndE-ValueType
RasGEFN 3 125 6.02e-27 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145611
Predicted Effect probably benign
Transcript: ENSMUST00000146601
SMART Domains Protein: ENSMUSP00000117681
Gene: ENSMUSG00000032946

DomainStartEndE-ValueType
Blast:RasGEFN 3 58 1e-35 BLAST
SCOP:d1bkds_ 9 58 1e-8 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000146831
SMART Domains Protein: ENSMUSP00000120630
Gene: ENSMUSG00000032946

DomainStartEndE-ValueType
RasGEFN 3 126 3.56e-29 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148906
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149205
Predicted Effect probably benign
Transcript: ENSMUST00000150713
SMART Domains Protein: ENSMUSP00000120949
Gene: ENSMUSG00000032946

DomainStartEndE-ValueType
RasGEFN 3 95 6.73e-7 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152022
Predicted Effect probably damaging
Transcript: ENSMUST00000167240
AA Change: L199P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000129873
Gene: ENSMUSG00000032946
AA Change: L199P

DomainStartEndE-ValueType
RasGEFN 3 126 3.56e-29 SMART
RasGEF 150 388 1.08e-100 SMART
EFh 430 458 8.25e-3 SMART
EFh 459 487 1.42e1 SMART
C1 499 548 3.22e-14 SMART
low complexity region 575 595 N/A INTRINSIC
Meta Mutation Damage Score 0.9419 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.6%
Validation Efficiency 100% (65/65)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a brain-enriched nucleotide exchanged factor that contains an N-terminal GEF domain, 2 tandem repeats of EF-hand calcium-binding motifs, and a C-terminal diacylglycerol/phorbol ester-binding domain. This protein can activate small GTPases, including RAS and RAP1/RAS3. The nucleotide exchange activity of this protein can be stimulated by calcium and diacylglycerol. Four alternatively spliced transcript variants encoding two different isoforms have been found for this gene. [provided by RefSeq, Jan 2016]
PHENOTYPE: Mice homozygous for a knock-out allele do not undergo spontaneous hemorrhaging but exhibit impaired platelet aggregation, resistance to collagen-induced thrombosis, and increased bleeding times after tail transection. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb5 T A 12: 118,868,669 E1190V probably damaging Het
Arhgef10 A G 8: 14,979,998 T928A probably benign Het
Arhgef10l T A 4: 140,515,451 I836F probably benign Het
Blm T A 7: 80,502,862 T446S probably benign Het
Ccdc63 T A 5: 122,122,750 Q237L probably damaging Het
Cep57l1 G T 10: 41,729,360 R130S probably damaging Het
Clstn2 T G 9: 97,457,560 E786A possibly damaging Het
Col16a1 C T 4: 130,068,752 P540L probably damaging Het
Csf2 A G 11: 54,249,333 F61L probably damaging Het
Ctr9 C T 7: 111,055,543 R1094C unknown Het
Cyp3a41a A G 5: 145,713,540 C98R probably damaging Het
Dthd1 T A 5: 62,827,165 C404* probably null Het
Egfem1 A C 3: 29,686,731 H518P probably benign Het
Elf3 T C 1: 135,254,277 S369G probably benign Het
Eml6 C T 11: 29,838,577 V503M probably damaging Het
Enthd1 T C 15: 80,560,039 D105G probably damaging Het
Eral1 A G 11: 78,075,602 L250P probably damaging Het
Gdf15 A T 8: 70,629,955 M167K probably benign Het
Ggps1 T C 13: 14,053,699 K300E probably benign Het
Gm8074 G A 9: 78,322,336 noncoding transcript Het
Herc3 A G 6: 58,876,837 I623V probably damaging Het
Mad1l1 A G 5: 140,132,816 S457P probably damaging Het
Map1lc3a G T 2: 155,277,542 V91F possibly damaging Het
Map4k3 A G 17: 80,605,965 V617A probably benign Het
Mov10l1 T A 15: 88,995,032 probably benign Het
Mroh2a A G 1: 88,258,664 S64G probably benign Het
Ncor1 G T 11: 62,329,668 probably null Het
Nfe2 C T 15: 103,250,937 E36K possibly damaging Het
Olfr1176 T C 2: 88,343,800 probably null Het
Olfr1212 A G 2: 88,959,273 K269R probably benign Het
Olfr1251 T C 2: 89,667,662 I75V probably benign Het
Olfr653 T C 7: 104,580,368 F241L probably benign Het
Oprm1 G A 10: 6,829,087 V95I probably benign Het
Pcdha9 T A 18: 36,997,942 H21Q probably benign Het
Pcolce2 A T 9: 95,638,755 I62F probably damaging Het
Pfpl T A 19: 12,429,689 C435S probably damaging Het
Pkhd1l1 G A 15: 44,498,557 C542Y probably damaging Het
Plekha5 T C 6: 140,583,871 S75P probably damaging Het
Pphln1 C A 15: 93,465,106 A202E probably damaging Het
Ppp1r1a A G 15: 103,532,454 L92P probably damaging Het
Prokr2 T C 2: 132,381,494 T43A probably benign Het
Rai14 T C 15: 10,592,212 N199S probably benign Het
Rnf213 A C 11: 119,482,448 M4939L possibly damaging Het
Slc23a2 C T 2: 132,060,683 R533Q probably benign Het
Slc7a7 T C 14: 54,373,091 probably null Het
Snrpd2 T A 7: 19,151,307 V31E probably damaging Het
Spire1 G T 18: 67,529,031 probably null Het
Srsf4 T C 4: 131,900,543 probably benign Het
Tcf20 A G 15: 82,853,429 S1274P probably damaging Het
Tcof1 C A 18: 60,832,903 A376S possibly damaging Het
Thsd1 T A 8: 22,243,164 Y76N possibly damaging Het
Timm44 A G 8: 4,260,561 V397A probably benign Het
Tmc6 G A 11: 117,778,261 T89I possibly damaging Het
Trbv31 C A 6: 41,557,705 C107F probably damaging Het
Trim37 T A 11: 87,140,603 probably null Het
Ttll5 T C 12: 86,012,799 V1226A probably benign Het
Ube3b T C 5: 114,412,870 V865A probably benign Het
Vmn2r86 A T 10: 130,447,097 M550K probably damaging Het
Vps54 C A 11: 21,300,183 T373N probably benign Het
Wdr64 T G 1: 175,805,856 I891S probably benign Het
Wisp2 A G 2: 163,828,984 D137G probably damaging Het
Zfhx4 C T 3: 5,398,859 S1384L probably damaging Het
Zfp703 A G 8: 26,979,085 E259G possibly damaging Het
Zfp933 T C 4: 147,826,512 H209R probably damaging Het
Zfp980 A G 4: 145,702,600 H633R probably damaging Het
Other mutations in Rasgrp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01013:Rasgrp2 APN 19 6404383 missense probably damaging 1.00
IGL03053:Rasgrp2 APN 19 6407332 splice site probably benign
thither UTSW 19 6404727 missense probably damaging 1.00
R1593:Rasgrp2 UTSW 19 6403460 missense possibly damaging 0.77
R1604:Rasgrp2 UTSW 19 6407057 missense possibly damaging 0.62
R2016:Rasgrp2 UTSW 19 6413165 missense probably benign 0.01
R2017:Rasgrp2 UTSW 19 6413165 missense probably benign 0.01
R2119:Rasgrp2 UTSW 19 6404395 missense probably benign 0.00
R2120:Rasgrp2 UTSW 19 6404395 missense probably benign 0.00
R2122:Rasgrp2 UTSW 19 6404395 missense probably benign 0.00
R2124:Rasgrp2 UTSW 19 6404395 missense probably benign 0.00
R3879:Rasgrp2 UTSW 19 6413890 missense probably benign 0.07
R4655:Rasgrp2 UTSW 19 6404846 intron probably benign
R5250:Rasgrp2 UTSW 19 6404313 missense probably damaging 1.00
R5320:Rasgrp2 UTSW 19 6408834 splice site probably null
R5620:Rasgrp2 UTSW 19 6405001 missense probably damaging 1.00
R5933:Rasgrp2 UTSW 19 6402513 missense probably damaging 1.00
R6155:Rasgrp2 UTSW 19 6402501 missense probably damaging 1.00
R6157:Rasgrp2 UTSW 19 6402501 missense probably damaging 1.00
R6867:Rasgrp2 UTSW 19 6413183 missense probably benign 0.00
R7237:Rasgrp2 UTSW 19 6404808 missense possibly damaging 0.79
R7575:Rasgrp2 UTSW 19 6404367 missense probably damaging 0.99
R7659:Rasgrp2 UTSW 19 6401827 missense probably damaging 0.98
R7744:Rasgrp2 UTSW 19 6405001 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGGCGGTTTCATCAAATGACAG -3'
(R):5'- TGTTGAAGTTCTGCAGCTGC -3'

Sequencing Primer
(F):5'- CGGTTTCATCAAATGACAGAGGGAG -3'
(R):5'- TGCAGCAGCCTCTGGAAG -3'
Posted On2015-04-30