Mutagenetix > Incidental Mutation

Incidental Mutation 'R4049:Pfpl'

314076

Institutional Source

Beutler Lab

Gene Symbol

Pfpl

Ensembl Gene

ENSMUSG00000040065

Gene Name

pore forming protein-like

Synonyms

Epcs5, Epcs50

MMRRC Submission

041616-MU

Accession Numbers

Genbank: NM_019540; MGI: 1860266

Is this an essential gene?

Probably non essential (E-score: 0.095) question?

Stock #

R4049 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

12427905-12432110 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 12429689 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Cysteine to Serine at position 435 (C435S)

Ref Sequence

ENSEMBL: ENSMUSP00000126346 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000168148]

AlphaFold

Q5RKV8

Predicted Effect

probably damaging
Transcript: ENSMUST00000168148
AA Change: C435S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000126346
Gene: ENSMUSG00000040065
AA Change: C435S

Domain	Start	End	E-Value	Type
signal peptide	1	17	N/A	INTRINSIC
MACPF	144	343	6.26e-33	SMART
transmembrane domain	643	665	N/A	INTRINSIC

Meta Mutation Damage Score

0.6467

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.1%
20x: 94.6%

Validation Efficiency

100% (65/65)

Allele List at MGI

Other mutations in this stock

Total: 65 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcb5	T	A	12: 118,868,669	E1190V	probably damaging	Het
Arhgef10	A	G	8: 14,979,998	T928A	probably benign	Het
Arhgef10l	T	A	4: 140,515,451	I836F	probably benign	Het
Blm	T	A	7: 80,502,862	T446S	probably benign	Het
Ccdc63	T	A	5: 122,122,750	Q237L	probably damaging	Het
Cep57l1	G	T	10: 41,729,360	R130S	probably damaging	Het
Clstn2	T	G	9: 97,457,560	E786A	possibly damaging	Het
Col16a1	C	T	4: 130,068,752	P540L	probably damaging	Het
Csf2	A	G	11: 54,249,333	F61L	probably damaging	Het
Ctr9	C	T	7: 111,055,543	R1094C	unknown	Het
Cyp3a41a	A	G	5: 145,713,540	C98R	probably damaging	Het
Dthd1	T	A	5: 62,827,165	C404*	probably null	Het
Egfem1	A	C	3: 29,686,731	H518P	probably benign	Het
Elf3	T	C	1: 135,254,277	S369G	probably benign	Het
Eml6	C	T	11: 29,838,577	V503M	probably damaging	Het
Enthd1	T	C	15: 80,560,039	D105G	probably damaging	Het
Eral1	A	G	11: 78,075,602	L250P	probably damaging	Het
Gdf15	A	T	8: 70,629,955	M167K	probably benign	Het
Ggps1	T	C	13: 14,053,699	K300E	probably benign	Het
Gm8074	G	A	9: 78,322,336		noncoding transcript	Het
Herc3	A	G	6: 58,876,837	I623V	probably damaging	Het
Mad1l1	A	G	5: 140,132,816	S457P	probably damaging	Het
Map1lc3a	G	T	2: 155,277,542	V91F	possibly damaging	Het
Map4k3	A	G	17: 80,605,965	V617A	probably benign	Het
Mov10l1	T	A	15: 88,995,032		probably benign	Het
Mroh2a	A	G	1: 88,258,664	S64G	probably benign	Het
Ncor1	G	T	11: 62,329,668		probably null	Het
Nfe2	C	T	15: 103,250,937	E36K	possibly damaging	Het
Olfr1176	T	C	2: 88,343,800		probably null	Het
Olfr1212	A	G	2: 88,959,273	K269R	probably benign	Het
Olfr1251	T	C	2: 89,667,662	I75V	probably benign	Het
Olfr653	T	C	7: 104,580,368	F241L	probably benign	Het
Oprm1	G	A	10: 6,829,087	V95I	probably benign	Het
Pcdha9	T	A	18: 36,997,942	H21Q	probably benign	Het
Pcolce2	A	T	9: 95,638,755	I62F	probably damaging	Het
Pkhd1l1	G	A	15: 44,498,557	C542Y	probably damaging	Het
Plekha5	T	C	6: 140,583,871	S75P	probably damaging	Het
Pphln1	C	A	15: 93,465,106	A202E	probably damaging	Het
Ppp1r1a	A	G	15: 103,532,454	L92P	probably damaging	Het
Prokr2	T	C	2: 132,381,494	T43A	probably benign	Het
Rai14	T	C	15: 10,592,212	N199S	probably benign	Het
Rasgrp2	T	C	19: 6,404,727	L199P	probably damaging	Het
Rnf213	A	C	11: 119,482,448	M4939L	possibly damaging	Het
Slc23a2	C	T	2: 132,060,683	R533Q	probably benign	Het
Slc7a7	T	C	14: 54,373,091		probably null	Het
Snrpd2	T	A	7: 19,151,307	V31E	probably damaging	Het
Spire1	G	T	18: 67,529,031		probably null	Het
Srsf4	T	C	4: 131,900,543		probably benign	Het
Tcf20	A	G	15: 82,853,429	S1274P	probably damaging	Het
Tcof1	C	A	18: 60,832,903	A376S	possibly damaging	Het
Thsd1	T	A	8: 22,243,164	Y76N	possibly damaging	Het
Timm44	A	G	8: 4,260,561	V397A	probably benign	Het
Tmc6	G	A	11: 117,778,261	T89I	possibly damaging	Het
Trbv31	C	A	6: 41,557,705	C107F	probably damaging	Het
Trim37	T	A	11: 87,140,603		probably null	Het
Ttll5	T	C	12: 86,012,799	V1226A	probably benign	Het
Ube3b	T	C	5: 114,412,870	V865A	probably benign	Het
Vmn2r86	A	T	10: 130,447,097	M550K	probably damaging	Het
Vps54	C	A	11: 21,300,183	T373N	probably benign	Het
Wdr64	T	G	1: 175,805,856	I891S	probably benign	Het
Wisp2	A	G	2: 163,828,984	D137G	probably damaging	Het
Zfhx4	C	T	3: 5,398,859	S1384L	probably damaging	Het
Zfp703	A	G	8: 26,979,085	E259G	possibly damaging	Het
Zfp933	T	C	4: 147,826,512	H209R	probably damaging	Het
Zfp980	A	G	4: 145,702,600	H633R	probably damaging	Het

Other mutations in Pfpl

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00930:Pfpl	APN	19	12429645	missense	probably benign	0.00
IGL01298:Pfpl	APN	19	12428673	missense	possibly damaging	0.68
IGL01310:Pfpl	APN	19	12428610	missense	probably damaging	1.00
IGL02273:Pfpl	APN	19	12429963	missense	possibly damaging	0.96
IGL02532:Pfpl	APN	19	12428845	missense	probably damaging	1.00
IGL02611:Pfpl	APN	19	12430283	missense	probably benign
IGL02642:Pfpl	APN	19	12429743	missense	probably damaging	1.00
IGL02715:Pfpl	APN	19	12429781	nonsense	probably null
IGL03087:Pfpl	APN	19	12428877	missense	probably benign	0.06
IGL03223:Pfpl	APN	19	12430074	missense	probably damaging	1.00
IGL03253:Pfpl	APN	19	12430029	missense	probably damaging	0.99
pegged	UTSW	19	12429010	missense	probably damaging	1.00
D3080:Pfpl	UTSW	19	12428832	missense	probably damaging	0.98
R0276:Pfpl	UTSW	19	12429237	missense	probably damaging	1.00
R0433:Pfpl	UTSW	19	12429475	missense	probably damaging	1.00
R1004:Pfpl	UTSW	19	12430425	missense	probably benign	0.00
R1510:Pfpl	UTSW	19	12429696	missense	probably benign	0.31
R1759:Pfpl	UTSW	19	12429860	missense	probably damaging	1.00
R2009:Pfpl	UTSW	19	12429955	missense	possibly damaging	0.95
R2063:Pfpl	UTSW	19	12429873	missense	probably damaging	1.00
R2201:Pfpl	UTSW	19	12430479	missense	probably benign	0.01
R2656:Pfpl	UTSW	19	12430236	missense	probably benign
R2969:Pfpl	UTSW	19	12429543	missense	probably benign	0.00
R3003:Pfpl	UTSW	19	12430326	missense	possibly damaging	0.90
R3428:Pfpl	UTSW	19	12430313	missense	probably benign	0.37
R3904:Pfpl	UTSW	19	12430437	missense	probably benign	0.00
R4717:Pfpl	UTSW	19	12429254	missense	probably benign	0.07
R5343:Pfpl	UTSW	19	12428688	missense	probably damaging	0.99
R5804:Pfpl	UTSW	19	12429663	missense	probably benign	0.00
R6032:Pfpl	UTSW	19	12429383	missense	probably damaging	0.99
R6032:Pfpl	UTSW	19	12429383	missense	probably damaging	0.99
R6047:Pfpl	UTSW	19	12429233	missense	probably damaging	1.00
R6106:Pfpl	UTSW	19	12429461	missense	probably damaging	0.99
R6657:Pfpl	UTSW	19	12429926	missense	probably benign	0.36
R7467:Pfpl	UTSW	19	12428514	missense	probably damaging	1.00
R7720:Pfpl	UTSW	19	12429174	missense	probably benign	0.02
R8024:Pfpl	UTSW	19	12430206	missense	possibly damaging	0.94
R8370:Pfpl	UTSW	19	12429911	missense	probably damaging	0.99
R8730:Pfpl	UTSW	19	12428580	missense	probably damaging	1.00
R8974:Pfpl	UTSW	19	12428475	missense	probably damaging	1.00
R9147:Pfpl	UTSW	19	12428440	missense	possibly damaging	0.64
R9148:Pfpl	UTSW	19	12428440	missense	possibly damaging	0.64
R9248:Pfpl	UTSW	19	12429010	missense	probably damaging	1.00
R9283:Pfpl	UTSW	19	12428856	missense	probably damaging	1.00
R9542:Pfpl	UTSW	19	12428933	missense	probably damaging	1.00
R9560:Pfpl	UTSW	19	12428933	missense	probably damaging	1.00
R9561:Pfpl	UTSW	19	12428933	missense	probably damaging	1.00
R9663:Pfpl	UTSW	19	12430095	missense	probably damaging	1.00
R9670:Pfpl	UTSW	19	12429743	missense	probably damaging	1.00
R9721:Pfpl	UTSW	19	12428933	missense	probably damaging	1.00
R9722:Pfpl	UTSW	19	12428933	missense	probably damaging	1.00
R9723:Pfpl	UTSW	19	12428933	missense	probably damaging	1.00
R9759:Pfpl	UTSW	19	12428933	missense	probably damaging	1.00
R9761:Pfpl	UTSW	19	12428933	missense	probably damaging	1.00
R9762:Pfpl	UTSW	19	12428933	missense	probably damaging	1.00
Z1176:Pfpl	UTSW	19	12429941	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- GTGATGGTAAACTGGTCAACGC -3'
(R):5'- AAGTAACTGGTTGGGCACG -3'

Sequencing Primer
(F):5'- GTAAACTGGTCAACGCTCCCTTTG -3'
(R):5'- GCACGATGGTTCATTTGTCATAG -3'

Posted On

2015-04-30