Incidental Mutation 'R4050:Prg4'
ID 314081
Institutional Source Beutler Lab
Gene Symbol Prg4
Ensembl Gene ENSMUSG00000006014
Gene Name proteoglycan 4 (megakaryocyte stimulating factor, articular superficial zone protein)
Synonyms MSF, SZP, lubricin, DOL54
MMRRC Submission 040968-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.125) question?
Stock # R4050 (G1)
Quality Score 225
Status Not validated
Chromosome 1
Chromosomal Location 150325163-150341916 bp(-) (GRCm39)
Type of Mutation intron
DNA Base Change (assembly) G to C at 150330510 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000125551 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006171] [ENSMUST00000111901] [ENSMUST00000111902] [ENSMUST00000119161] [ENSMUST00000124484] [ENSMUST00000124973] [ENSMUST00000164600] [ENSMUST00000161611] [ENSMUST00000162367] [ENSMUST00000159035] [ENSMUST00000161320]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000006171
SMART Domains Protein: ENSMUSP00000006171
Gene: ENSMUSG00000006014

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
SO 26 68 9.21e-18 SMART
SO 69 108 4.21e-12 SMART
low complexity region 110 124 N/A INTRINSIC
HX 169 211 1.67e-7 SMART
HX 213 256 3.76e-10 SMART
Blast:HX 369 422 2e-27 BLAST
Predicted Effect unknown
Transcript: ENSMUST00000111901
AA Change: P465R
SMART Domains Protein: ENSMUSP00000107532
Gene: ENSMUSG00000006014
AA Change: P465R

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
SO 26 68 9.21e-18 SMART
SO 69 108 4.21e-12 SMART
low complexity region 110 124 N/A INTRINSIC
low complexity region 141 151 N/A INTRINSIC
low complexity region 189 221 N/A INTRINSIC
low complexity region 241 535 N/A INTRINSIC
low complexity region 570 623 N/A INTRINSIC
HX 711 753 1.67e-7 SMART
HX 755 798 3.76e-10 SMART
Blast:HX 911 964 5e-27 BLAST
Predicted Effect unknown
Transcript: ENSMUST00000111902
AA Change: P512R
SMART Domains Protein: ENSMUSP00000107533
Gene: ENSMUSG00000006014
AA Change: P512R

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
SO 25 67 2.71e-15 SMART
low complexity region 69 81 N/A INTRINSIC
low complexity region 86 143 N/A INTRINSIC
low complexity region 150 171 N/A INTRINSIC
low complexity region 188 198 N/A INTRINSIC
low complexity region 236 268 N/A INTRINSIC
low complexity region 288 582 N/A INTRINSIC
internal_repeat_1 588 614 2.72e-5 PROSPERO
low complexity region 617 670 N/A INTRINSIC
internal_repeat_1 680 706 2.72e-5 PROSPERO
HX 758 800 1.67e-7 SMART
HX 802 845 3.76e-10 SMART
Blast:HX 958 1011 4e-27 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000119161
SMART Domains Protein: ENSMUSP00000112606
Gene: ENSMUSG00000006005

DomainStartEndE-ValueType
coiled coil region 49 370 N/A INTRINSIC
coiled coil region 423 515 N/A INTRINSIC
low complexity region 518 534 N/A INTRINSIC
coiled coil region 539 604 N/A INTRINSIC
low complexity region 690 703 N/A INTRINSIC
low complexity region 782 795 N/A INTRINSIC
low complexity region 811 826 N/A INTRINSIC
low complexity region 1003 1019 N/A INTRINSIC
Pfam:TPR_MLP1_2 1036 1167 9.1e-33 PFAM
coiled coil region 1215 1421 N/A INTRINSIC
coiled coil region 1473 1629 N/A INTRINSIC
internal_repeat_3 1630 1691 1.48e-5 PROSPERO
low complexity region 1695 1717 N/A INTRINSIC
low complexity region 1761 1777 N/A INTRINSIC
internal_repeat_5 1814 1827 5.58e-5 PROSPERO
internal_repeat_3 1819 1881 1.48e-5 PROSPERO
internal_repeat_4 1875 1895 5.58e-5 PROSPERO
internal_repeat_1 1893 1919 2.03e-6 PROSPERO
low complexity region 1920 1933 N/A INTRINSIC
low complexity region 1942 1981 N/A INTRINSIC
low complexity region 1989 2014 N/A INTRINSIC
internal_repeat_4 2017 2036 5.58e-5 PROSPERO
low complexity region 2059 2078 N/A INTRINSIC
internal_repeat_2 2084 2135 3.95e-6 PROSPERO
internal_repeat_5 2127 2140 5.58e-5 PROSPERO
internal_repeat_1 2154 2179 2.03e-6 PROSPERO
internal_repeat_2 2156 2212 3.95e-6 PROSPERO
low complexity region 2239 2251 N/A INTRINSIC
low complexity region 2263 2277 N/A INTRINSIC
low complexity region 2292 2314 N/A INTRINSIC
low complexity region 2346 2357 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000124484
SMART Domains Protein: ENSMUSP00000121991
Gene: ENSMUSG00000006005

DomainStartEndE-ValueType
low complexity region 26 38 N/A INTRINSIC
low complexity region 50 64 N/A INTRINSIC
low complexity region 79 101 N/A INTRINSIC
low complexity region 133 144 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000124973
SMART Domains Protein: ENSMUSP00000117616
Gene: ENSMUSG00000006005

DomainStartEndE-ValueType
low complexity region 3 14 N/A INTRINSIC
low complexity region 24 77 N/A INTRINSIC
coiled coil region 123 444 N/A INTRINSIC
coiled coil region 497 589 N/A INTRINSIC
low complexity region 592 608 N/A INTRINSIC
coiled coil region 613 678 N/A INTRINSIC
low complexity region 764 777 N/A INTRINSIC
low complexity region 856 869 N/A INTRINSIC
low complexity region 885 900 N/A INTRINSIC
low complexity region 1077 1093 N/A INTRINSIC
Pfam:TPR_MLP1_2 1112 1240 5.1e-37 PFAM
coiled coil region 1289 1495 N/A INTRINSIC
low complexity region 1682 1698 N/A INTRINSIC
internal_repeat_5 1703 1750 8.04e-5 PROSPERO
internal_repeat_3 1704 1765 1.07e-5 PROSPERO
low complexity region 1769 1791 N/A INTRINSIC
low complexity region 1835 1851 N/A INTRINSIC
internal_repeat_5 1857 1900 8.04e-5 PROSPERO
internal_repeat_6 1887 1911 8.04e-5 PROSPERO
internal_repeat_3 1893 1955 1.07e-5 PROSPERO
internal_repeat_4 1949 1969 4.1e-5 PROSPERO
internal_repeat_1 1967 1993 1.42e-6 PROSPERO
low complexity region 1994 2007 N/A INTRINSIC
low complexity region 2016 2055 N/A INTRINSIC
low complexity region 2063 2088 N/A INTRINSIC
internal_repeat_4 2091 2110 4.1e-5 PROSPERO
internal_repeat_6 2108 2132 8.04e-5 PROSPERO
low complexity region 2133 2152 N/A INTRINSIC
internal_repeat_2 2158 2209 2.78e-6 PROSPERO
internal_repeat_1 2228 2253 1.42e-6 PROSPERO
internal_repeat_2 2230 2286 2.78e-6 PROSPERO
low complexity region 2313 2325 N/A INTRINSIC
low complexity region 2337 2351 N/A INTRINSIC
low complexity region 2366 2388 N/A INTRINSIC
low complexity region 2420 2431 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128417
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130779
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138718
Predicted Effect unknown
Transcript: ENSMUST00000164600
AA Change: P721R
SMART Domains Protein: ENSMUSP00000128943
Gene: ENSMUSG00000006014
AA Change: P721R

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
SO 26 68 9.21e-18 SMART
SO 69 108 2.77e-12 SMART
low complexity region 110 122 N/A INTRINSIC
low complexity region 127 184 N/A INTRINSIC
low complexity region 191 212 N/A INTRINSIC
low complexity region 229 239 N/A INTRINSIC
internal_repeat_3 244 271 7.42e-5 PROSPERO
low complexity region 277 309 N/A INTRINSIC
Pfam:Cornifin 404 497 2.4e-14 PFAM
Pfam:Cornifin 468 584 3.2e-15 PFAM
Pfam:Cornifin 550 648 3.3e-16 PFAM
Pfam:Cornifin 625 722 2.1e-15 PFAM
Pfam:Cornifin 647 743 7.8e-16 PFAM
Pfam:Cornifin 706 822 1.4e-12 PFAM
low complexity region 826 879 N/A INTRINSIC
internal_repeat_2 889 915 1.24e-5 PROSPERO
HX 967 1009 1.67e-7 SMART
HX 1011 1054 3.76e-10 SMART
Blast:HX 1167 1220 6e-27 BLAST
Predicted Effect unknown
Transcript: ENSMUST00000161611
AA Change: P721R
SMART Domains Protein: ENSMUSP00000125677
Gene: ENSMUSG00000006014
AA Change: P721R

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
SO 26 68 9.21e-18 SMART
SO 69 108 2.77e-12 SMART
low complexity region 110 122 N/A INTRINSIC
low complexity region 127 184 N/A INTRINSIC
low complexity region 191 212 N/A INTRINSIC
low complexity region 229 239 N/A INTRINSIC
internal_repeat_3 244 271 7.42e-5 PROSPERO
low complexity region 277 309 N/A INTRINSIC
Pfam:Cornifin 578 691 2.2e-9 PFAM
internal_repeat_3 796 825 7.42e-5 PROSPERO
internal_repeat_2 797 823 1.24e-5 PROSPERO
low complexity region 826 879 N/A INTRINSIC
internal_repeat_2 889 915 1.24e-5 PROSPERO
HX 967 1009 1.67e-7 SMART
HX 1011 1054 3.76e-10 SMART
Blast:HX 1167 1220 6e-27 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152967
Predicted Effect probably benign
Transcript: ENSMUST00000162367
SMART Domains Protein: ENSMUSP00000125551
Gene: ENSMUSG00000006014

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
SO 26 68 9.21e-18 SMART
SO 69 108 4.21e-12 SMART
low complexity region 110 124 N/A INTRINSIC
HX 169 211 1.67e-7 SMART
HX 213 256 3.76e-10 SMART
Blast:HX 369 422 2e-27 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000159035
SMART Domains Protein: ENSMUSP00000124410
Gene: ENSMUSG00000006014

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
SO 25 67 2.71e-15 SMART
low complexity region 69 81 N/A INTRINSIC
low complexity region 88 99 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000161320
SMART Domains Protein: ENSMUSP00000124801
Gene: ENSMUSG00000006014

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
SO 25 67 3.83e-15 SMART
low complexity region 69 83 N/A INTRINSIC
low complexity region 100 110 N/A INTRINSIC
low complexity region 148 179 N/A INTRINSIC
Meta Mutation Damage Score 0.1518 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.5%
Validation Efficiency 97% (58/60)
MGI Phenotype PHENOTYPE: Aging homozygous null mice develop a hopping gait, irregular endochondral growth plates, altered cartilage surface, camptodactyly, progressive synovial hyperplasia and, ultimately, joint failure. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2510039O18Rik A G 4: 148,029,449 (GRCm39) D473G probably damaging Het
Abca1 T A 4: 53,044,144 (GRCm39) Q1826L probably damaging Het
Apob G A 12: 8,065,390 (GRCm39) V4087I probably benign Het
Atp10b G A 11: 43,150,363 (GRCm39) A1354T probably benign Het
Baz1a A G 12: 54,976,404 (GRCm39) V424A probably benign Het
Cdc20b G A 13: 113,200,819 (GRCm39) D180N probably benign Het
Cep57l1 G T 10: 41,605,356 (GRCm39) R130S probably damaging Het
Ddb1 A G 19: 10,605,171 (GRCm39) D1053G probably benign Het
Ddx39a T A 8: 84,448,863 (GRCm39) M246K probably benign Het
Dip2a G A 10: 76,114,441 (GRCm39) T1013M probably damaging Het
Edar G T 10: 58,445,769 (GRCm39) T265N possibly damaging Het
Fcgbpl1 T C 7: 27,852,410 (GRCm39) V1311A possibly damaging Het
Gbp8 T A 5: 105,179,104 (GRCm39) I132F probably damaging Het
Gga1 A G 15: 78,775,691 (GRCm39) D382G probably benign Het
Ggps1 T C 13: 14,228,284 (GRCm39) K300E probably benign Het
Gm10518 C A 1: 179,631,378 (GRCm39) probably benign Het
Gm8074 G A 9: 78,229,618 (GRCm39) noncoding transcript Het
H2-Eb1 T A 17: 34,533,342 (GRCm39) L188Q probably damaging Het
Heatr6 A G 11: 83,646,599 (GRCm39) S95G probably damaging Het
Hnf1a T A 5: 115,108,633 (GRCm39) N91Y probably damaging Het
Ints10 C T 8: 69,280,003 (GRCm39) S710F probably damaging Het
Kazn C T 4: 141,834,215 (GRCm39) E614K unknown Het
Kif26a T A 12: 112,146,350 (GRCm39) M1812K probably benign Het
Lmo7 A T 14: 102,139,713 (GRCm39) K488* probably null Het
Mad1l1 A G 5: 140,118,571 (GRCm39) S457P probably damaging Het
Met A G 6: 17,533,983 (GRCm39) T645A probably benign Het
Mpp4 T C 1: 59,185,903 (GRCm39) probably null Het
Mycl A T 4: 122,890,632 (GRCm39) probably null Het
Ncbp1 G A 4: 46,147,483 (GRCm39) R110H probably damaging Het
Nfasc G T 1: 132,538,043 (GRCm39) probably benign Het
Nup35 A G 2: 80,486,320 (GRCm39) I212V probably benign Het
Or2y8 T G 11: 52,035,961 (GRCm39) Y132S probably damaging Het
Or4p20 A G 2: 88,253,967 (GRCm39) M134T probably damaging Het
Ovgp1 T C 3: 105,893,883 (GRCm39) probably benign Het
Ovgp1 A G 3: 105,893,912 (GRCm39) probably benign Het
Pcgf5 G A 19: 36,420,311 (GRCm39) S181N probably damaging Het
Plk2 C T 13: 110,536,400 (GRCm39) T617I probably damaging Het
Polq A T 16: 36,913,182 (GRCm39) probably null Het
Ppp1r1a A G 15: 103,440,881 (GRCm39) L92P probably damaging Het
Pramel24 T C 4: 143,453,692 (GRCm39) S267P probably benign Het
Prune1 T C 3: 95,169,542 (GRCm39) K220R possibly damaging Het
Rab3gap2 G A 1: 185,004,840 (GRCm39) probably null Het
Rufy4 T C 1: 74,186,822 (GRCm39) C537R probably damaging Het
Sall3 G A 18: 81,014,697 (GRCm39) A1005V probably benign Het
Samd15 T G 12: 87,247,406 (GRCm39) N30K probably benign Het
Scn8a A T 15: 100,911,294 (GRCm39) K905* probably null Het
Scrib G A 15: 75,923,322 (GRCm39) R1245W possibly damaging Het
Skint4 C T 4: 111,981,811 (GRCm39) S260L probably benign Het
Slc29a2 A T 19: 5,079,481 (GRCm39) M339L possibly damaging Het
Slx9 T C 10: 77,350,164 (GRCm39) R75G possibly damaging Het
Spire1 G T 18: 67,662,101 (GRCm39) probably null Het
Synpo2 T C 3: 122,907,927 (GRCm39) D463G possibly damaging Het
Taf4 C A 2: 179,573,805 (GRCm39) G688C probably damaging Het
Tasor2 A G 13: 3,623,507 (GRCm39) S2148P probably benign Het
Tpte T A 8: 22,856,000 (GRCm39) V600E probably damaging Het
Ttn A G 2: 76,651,510 (GRCm39) V10953A probably benign Het
Vav2 T C 2: 27,178,691 (GRCm39) Y333C probably benign Het
Vav2 A G 2: 27,181,415 (GRCm39) S311P probably damaging Het
Zbtb26 A C 2: 37,327,000 (GRCm39) M1R probably null Het
Zfp26 G A 9: 20,353,525 (GRCm39) P88L probably benign Het
Zfp324 T C 7: 12,704,794 (GRCm39) F328L probably damaging Het
Other mutations in Prg4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00493:Prg4 APN 1 150,327,671 (GRCm39) missense probably damaging 0.99
IGL02033:Prg4 APN 1 150,331,619 (GRCm39) intron probably benign
IGL02154:Prg4 APN 1 150,330,613 (GRCm39) intron probably benign
IGL03111:Prg4 APN 1 150,327,653 (GRCm39) missense probably benign 0.06
IGL03177:Prg4 APN 1 150,331,354 (GRCm39) intron probably benign
IGL03260:Prg4 APN 1 150,331,378 (GRCm39) intron probably benign
IGL03281:Prg4 APN 1 150,325,839 (GRCm39) splice site probably benign
R0046:Prg4 UTSW 1 150,331,837 (GRCm39) missense possibly damaging 0.53
R0046:Prg4 UTSW 1 150,331,837 (GRCm39) missense possibly damaging 0.53
R0196:Prg4 UTSW 1 150,330,243 (GRCm39) intron probably benign
R0233:Prg4 UTSW 1 150,329,298 (GRCm39) splice site probably benign
R0255:Prg4 UTSW 1 150,331,558 (GRCm39) intron probably benign
R0616:Prg4 UTSW 1 150,336,462 (GRCm39) missense probably damaging 1.00
R1016:Prg4 UTSW 1 150,330,442 (GRCm39) intron probably benign
R1826:Prg4 UTSW 1 150,327,760 (GRCm39) missense probably benign 0.09
R1862:Prg4 UTSW 1 150,336,420 (GRCm39) missense probably damaging 0.99
R1863:Prg4 UTSW 1 150,336,420 (GRCm39) missense probably damaging 0.99
R1922:Prg4 UTSW 1 150,325,750 (GRCm39) nonsense probably null
R1940:Prg4 UTSW 1 150,331,774 (GRCm39) missense possibly damaging 0.53
R3765:Prg4 UTSW 1 150,327,122 (GRCm39) missense probably damaging 0.97
R3855:Prg4 UTSW 1 150,327,751 (GRCm39) missense probably damaging 1.00
R3894:Prg4 UTSW 1 150,330,510 (GRCm39) intron probably benign
R3895:Prg4 UTSW 1 150,330,510 (GRCm39) intron probably benign
R3912:Prg4 UTSW 1 150,327,619 (GRCm39) missense probably damaging 1.00
R3935:Prg4 UTSW 1 150,333,908 (GRCm39) missense possibly damaging 0.68
R4475:Prg4 UTSW 1 150,330,610 (GRCm39) intron probably benign
R4794:Prg4 UTSW 1 150,330,297 (GRCm39) intron probably benign
R4910:Prg4 UTSW 1 150,331,574 (GRCm39) intron probably benign
R4911:Prg4 UTSW 1 150,331,574 (GRCm39) intron probably benign
R4993:Prg4 UTSW 1 150,336,432 (GRCm39) missense probably damaging 1.00
R5378:Prg4 UTSW 1 150,330,977 (GRCm39) intron probably benign
R5381:Prg4 UTSW 1 150,330,204 (GRCm39) intron probably benign
R5452:Prg4 UTSW 1 150,331,519 (GRCm39) intron probably benign
R5870:Prg4 UTSW 1 150,331,300 (GRCm39) nonsense probably null
R5888:Prg4 UTSW 1 150,328,101 (GRCm39) missense probably damaging 1.00
R5929:Prg4 UTSW 1 150,329,880 (GRCm39) missense probably benign 0.01
R6058:Prg4 UTSW 1 150,327,197 (GRCm39) missense probably damaging 0.99
R6059:Prg4 UTSW 1 150,325,748 (GRCm39) missense possibly damaging 0.67
R6232:Prg4 UTSW 1 150,331,567 (GRCm39) intron probably benign
R6272:Prg4 UTSW 1 150,330,517 (GRCm39) intron probably benign
R6459:Prg4 UTSW 1 150,330,052 (GRCm39) intron probably benign
R6659:Prg4 UTSW 1 150,336,432 (GRCm39) missense probably damaging 1.00
R6663:Prg4 UTSW 1 150,330,852 (GRCm39) intron probably benign
R6882:Prg4 UTSW 1 150,329,246 (GRCm39) missense probably damaging 1.00
R6970:Prg4 UTSW 1 150,331,657 (GRCm39) intron probably benign
R7078:Prg4 UTSW 1 150,334,014 (GRCm39) missense possibly damaging 0.91
R7102:Prg4 UTSW 1 150,328,005 (GRCm39) missense probably damaging 1.00
R7264:Prg4 UTSW 1 150,329,818 (GRCm39) missense not run
R7487:Prg4 UTSW 1 150,331,656 (GRCm39) missense unknown
R7531:Prg4 UTSW 1 150,330,786 (GRCm39) missense unknown
R7651:Prg4 UTSW 1 150,330,696 (GRCm39) missense unknown
R7701:Prg4 UTSW 1 150,333,293 (GRCm39) missense possibly damaging 0.53
R8072:Prg4 UTSW 1 150,331,774 (GRCm39) missense possibly damaging 0.53
R8168:Prg4 UTSW 1 150,331,601 (GRCm39) missense unknown
R8248:Prg4 UTSW 1 150,330,877 (GRCm39) missense unknown
R8436:Prg4 UTSW 1 150,331,318 (GRCm39) missense unknown
R8460:Prg4 UTSW 1 150,331,692 (GRCm39) missense possibly damaging 0.83
R8514:Prg4 UTSW 1 150,330,396 (GRCm39) missense unknown
R8904:Prg4 UTSW 1 150,331,810 (GRCm39) missense possibly damaging 0.83
R9072:Prg4 UTSW 1 150,331,288 (GRCm39) missense unknown
R9073:Prg4 UTSW 1 150,331,288 (GRCm39) missense unknown
R9274:Prg4 UTSW 1 150,331,924 (GRCm39) missense possibly damaging 0.53
R9337:Prg4 UTSW 1 150,327,116 (GRCm39) missense probably damaging 1.00
R9488:Prg4 UTSW 1 150,327,024 (GRCm39) missense probably benign
R9613:Prg4 UTSW 1 150,331,660 (GRCm39) missense unknown
R9670:Prg4 UTSW 1 150,326,618 (GRCm39) missense probably benign 0.01
X0024:Prg4 UTSW 1 150,330,243 (GRCm39) intron probably benign
Predicted Primers PCR Primer
(F):5'- AGCAGTTACTTTGGGTGCAAG -3'
(R):5'- ACTCTCAAGGAGCCTGAACC -3'

Sequencing Primer
(F):5'- CAAGAGTTGTTGCTTTCAGAGTAG -3'
(R):5'- CGCAAGGAGCCTGAACC -3'
Posted On 2015-04-30